Description :
From Genome Similarity Track
Location :
Scaffold_181:52104- 54088
Transcript NameFunction/comments
Phymu_g6214hypothetical protein

Sequence
1984 bases(100 bases per row)
TCTACTAAGTGTGTGACACACGATGTACCTATATGTGACTTACATCAAATATATCCATGTGTGAGACACACAAACGGCaacattcgtgtaacaccccgtt
acagTCGAAGTCCAGCAAGTTGATGCCGTTCTTGTCGTGGCCGGTCAGGTTCCACGCGTACTTCATGCAAGCTGTAGTTTCCAGGTAGCTCGTAAAAACA
TGGGTGATGGCGGCTAGGCGAGGTTTTGGGTCTTTATCGAACGGCGTGTACACACGGGACCACGGCGGGTTGAGCATGGTATCTAGCACAGAGTCGAAGA
TCCAGGGGATTCCCGACGCCAACATCTCACGAGCGGTGATGCGGCCTTGCTCGTAGTTCAGGTCGGGGTTGAACGTGGCGGCGGTATTGAACTGCTGGTC
GTAGTAGACGATGCCTGTGGTCATAGCGTTGCGACCGAAGTCAGCGCAGTATATTGTTTGGTAGCTAATCCTCAAAGCTGGTGAAAACCCAGCTGCCGCA
ATCGAACGACTCACAACGTCATCTAGAACAGCCTTCCATGATGTTTGGACCCACTGGGCCACTGGGACTCTGGACTCCCCGCCCATGATACGGCCTTGAT
GGAGTTTCAATACGGGAGAGTTGTTCGTGTGAACGGCCCCGACGTCAAAGGCTGCAGCACAGAGGAAGAGGTCGATCTCTCTGTGCTTAAGCGACACTAC
GTTCCAGCGGAAGAATGTGAAATGCTGTCAGGATTATATGTCGGACATCCAACGGTGTTTGTTCAACAGGACGGAGAAACTATGGACCAATGAGAGCTTG
GCGTGGTAACTGGTTATCGCATGACCGGCACGACCCCTTCGTTGCATGTCCGGGTACCTAGTGAGTCATGCAAAGTCCAACCCCAGCAGCCACTGACCGT
TATAAAGACTGTTTGGATTAATTACATGCTCCAGACAGGTGCAGTAATCAATGTGCTTACAATTCTCATCAGGGGCCGCTGAATCAGCTCCGTCGATCGC
GGGGAAGCGCAGAACACCTACGAGTACAGATACACGACCATCCACTCGCCAGaacgttcaagaagaaacactAGGGGATCAGCTGGGCGTAGGATCGCCA
CCTTTAACCGTCCACGACGATACCGGCATCGCGGCTGTTCTTTTCCAAAAGCTCCCCCTTCAAGACACGACCACACTGCCCGAACCGGAAGACATTTCAA
GCACGGTATTGGACGCAGTAGGGATGTGAACAGTCGCTCGGTAACGCTTCGCCCTGTATGATACTACCTTCCTGGAGCTCTGATGAACGGGCTGTACGAG
CAGAACTACTGCAACTTGAGGGCGCAGTTCGATCGGCGGGGATCATTTCGGTGCGATGACCACACCTGCGTGGAGCCGGACGCCGGTACTCATTGCTTCG
TATCTAGTCTTGCTCTACATAGAGCAATGGCAACAGTCTTAGACCCTTCGGCTATTAATGCGCGGAAGTTCTCGACATGAAGCACAACTTTCGGGTTTGA
ATGGTATATCAAGCTCGGAACCGTAACGATCCCAGaagagaagatcgccaaggcCCAGCTCCACGTTCAGGACGTCCTTGCTGCTAGGTCAGAGACAAAA
ACTTCAGTTCTAAGTCTACTGGGGAATTTGCATCATATCTCGACGTGTTGTCCACCTGCACGCGCATTTCCCAACGCTACAAGACGTGGCCATCTCGATC
AATCGGTACGGAAACCTCCATCTTCCAAGTTCAGAAATTGACGATCTCAAGTGATTTCAAATTATTTTACAGCACGAGGATTGTTTTAATCGAATATTGG
TGAAGTATTCTGCTGGCGTGGCTACCCCAACAGTACATGTTCAGATGAACACCTCTAACCAGAGGCTATGTGTATTGGAACCTACGAAAACAATTTATCC
GTCTATGATTCTCGGGATCGGTCCGGAAATCGTTCATGTACGCGGACCAGTATCGGGCAGAATAGTTACAGCTGGTCCGATTCA