Description :
From Genome Similarity Track
Location :
Scaffold_182:5210- 10032
Transcript NameFunction/comments
Phyta_totarag5189hypothetical protein PHYSODRAFT_484119
Phyta_totarag5190hypothetical protein
Phyta_totarag5191hypothetical protein PHYSODRAFT_312329

Sequence
4822 bases(100 bases per row)
CTCAACACCACCTGCGGCGGCAGTGTCACTTCCAGATCTGCCGTTGCATGCATCATGTCGTTGCTCCACggacgcagcatcttcttgcgcGGCGTGAGGC
GTCTCGACGTTGTACATCGGGCGCGCGGCCCGCCCATCTCCTCGCCCTTATGGCTAGGCCACCGTCGCCCCGCGTCGTTCGCGCTGCCTGCGCTGAGCAA
CAGCGTGTTGAGCTTCTCgacgtcggcgctggacgaaCATGAtaagaccaagaaggagaagctaAAGCCCAAGCAGCTGAACACGCTTAGCGGCATGGGA
CTGGACCGACCTCCCAACACGGCCAAGGAGATCCTGAGCTTCCTAATGGGCCACTTGTGGCCCAAGGAGGACTccaaggaggccaaggagatcaagcagA
AGGTGCTCGTCTCGGCGGGCCTCGTGGTAGCGTCTAAGGCATTGACGATCCAGGTGCCGTTCATCTTCAAGGAACTGGTGGACAGCATGGGCGCAGCCTC
CAGTGCATTGGCGGGATCGCCCGAGATTGCGGTGCCGCTGGCCATGGTGCTCGGCTACGGAGTAGCGAGATTCAGTGCCAGTGCGTCATCCGAACTGGCC
AATGCCGTGTTCGCTACGGTGGCTCAGAAGACCATTCGGAAGGTTGCAGTGCGGGTGTTCAAGCACTTGCACGCCATGGATCTGAAATTTCACTTGGACC
GGCAGACAGGGGCGCTGTCGCGCATCATTGACCGCGGCTCACGATCGATTGACTTTGTGCTGCGTGCTATGGCGTTCCGAGTGGTGCCGACAGTGCTGGA
GATTGGACTGGTGAGCACCATCATGGCTACGAGTTTTGGCCTGCCGTACGCGGGTGTGACACTGGGTACGCTTGCTGCGTATACGACGTTCACGGTGCTG
GTCACGCAGTGGCGTGATGAGATTCGCCGTGAGATGAATCGCCTTGAGAACGAGGCTGGCGCGAAGGTTATTGATTCGTTGATGAACTACGAGACGGTCA
AGTATTTTAACAACGAAGAGCACGAGACGGAGCGCTACGACGAATCGCTCAAGGGATACCAGAAAGCGGCTCTCAAGACACAGACGTCTTTGGCCATGCT
GAACGCCGGACAGAACGGTATCTTCAGCGTTGGTCTCACTGCCATCATGTACATGGCGTGTGAaggaattgctgctggctcgCTCACCGTTGGTGACTTG
GTGCTTGTGAATGGtttgctgttccagctgtCCATCCCTCTTAACTTCATTGGTAGCATTTACCGTGAAGTGCGCCAGTCGGTCACGGACATGGAGTCGA
TGTTCAAGCTGGGTGCTGTGACGCCTGTCATCACGAACCCGGACGAGAATTTGAGTCTAACGGGCAGGGAACCCAAGTCTATCGAGTTCCGCGATGTGGA
CTTCGGATACCGCTCGGAGCTCCCGATTTTGCGCAAGACGTCGTTCAAGGTTGACGCTGGCAAGCGTGTTGCTATCGTTGGCACGAGTGGTTCCGGCAAG
TCCACAGTACTCCGATTGCTCTACCGCTTCTACGACCCCCAGAATGGTACGATTCTCATTGACGGAAAGGATATTCGTCAGTTGAGTCTGGACGAACTGC
GCCAGGCGATTGCTATCGTCCCGCAGGACACCGTGTTGTTCAACGAAACGATATTCTACAACATTAACTACGGCCGCCTCGATGCGACGCCGGAGGAAGT
GATGAACGCCGCTCGTGTTTCGCAAATCCACCACTCGATCGAGACGTTCCCGGACGGATACAACACCCGCGTGGGTGAGCGCGGATTGAAGCTCTCCGGt
ggcgagaagcagcgtgTATCGATCGCGCGTGCGATGCTCAAGGACTCGCCGATCTTGCTGTTCGACGAGGCCACCAGCGCCCTCGACTCGGAGACTGAGT
CGGAGATCGTGCGTGAGTTCGCGTCCATCGGCGCGAACCGCACGTCGCTGATCATTGCTCACCGTCTGTCCACCATCCAGAACGCCGACGAGATCatcgt
gttcgacaaggGACACGTGATCCAGCAGGGCTCCCACGAGGAGCTACTGCGCGACGTCGAGGGGAAGTACGCCGAGATGTGGGCTCGGCAGAACCACCAC
GTGCTCGGACTGCTcggcaacggcagcgacgatgacgagagcgagagcgagaccAAGGGAAGTGTATAGAAGCCCGTAGCTGTAGGTAGATTCACATGTT
GCATCTCTACAAAGGCAACAATCCcagcaagcacttcaacttgaaatgTATAATATGACGTGGTCCACTTCATTGTCATTCTCCACACCCTTGAGAAAGT
GACACAGCCAAAGGCTAAAAATAGCATCGCAGCATCGCAGGCTCCAGCTCCCTCGCAGCGGCCGCCatggacgcgctgctcgtgAGCGCGCATCgcctga
gcagcagctcgagctcgagcgcCAGTTCCTACAGTTccggcgacgacgaaccgCTCAGTCTCAAGCGCCACGCTCCGATGCCTCTGCCgccccctcctcc
tccagacTCTCCGCCCCCATACTtgacgccgccgcctccgcctgGACCTCCTCCGCCTGTCGATATAAAGCGCACGACAGCGCGACCACGACGCTCGAAG
ATCAATACTCAGACAGCCAAGAAAACAACGCGGAAGGCGACGTCCAAAGCTTCAGCGAAAAATCAAGTgaagaagccgccgccgccgactcGACGTCAGC
CGTCTCCAGTGAAGCAGCGACGTGCTGAAACTTCCACGGCTGAGAGTGTacaggacgaagaagagcagcaacaggaggaggagggagaagaggaggatgt
GGATGCGTATTCGGACGAGTCCGACGTGTTTGAAGAGGACGTCGAGGCCATTTTGTTcgcagaagaggaggaagaccgACGTAAAGGGTACACAGACTGT
CTGACGGAGACGCACTTGGACAGCGCAGAGTACCCGTACCCGGCGTATCTCGCCAAACTGTCGACGCTGTTTACGGAGCAAAGCGCGTTTGGGAAGAACC
CAGAGGACTTTATTTATTGCAACAACCTGTTGGTACGTTGCGGGAGATTGGTTGTACGTTGTGATGAGTGAACAATGAAGTGACTGATATTTGTATTATT
GCAGGTTAATCCGAGTCAGCTTAAGCTACTCGACACCCGGACTGCTGCACTAGAACGAGAGAAGTGGGCGCGAGTGCGAAAAGCAGCTACgctgaaggcg
aaggaggacgagaagaggAGACGTCGGGAAAGGTGAGCAGGTCTTTCATGATTCATGAGTGCTGCGGTTTTAAATTACGCAGACGATAACCCTGGAATGG
AttgtttgctgcttcaacagaCTAGTGGAAGCGCTGGAACCGCCTACCAAGAAGATCAAAATATCAGAAGCCACTCTAAATGCCTTGGAGTCCAAACAAA
CTGTATCTGTGAGCAAGTCGAGATCCTCGAGCAACCCCTCGCGGAAGCGAAGTCGAAAGAAACCCACTGCATCAACCGCATCAACCGCATCaacgacgcc
agcaacaccagctccttcgaATCCTCCTGATGCCCCCAAAGGTAGTAGCACAAAAGCAAAATCCAAGCCTGCGTCAGCACAGACAGCGAAAGTTAATGGG
AAGGCAAATGGTAAACCCGCGACTATTCCAGctaccaagaagaagacgacggctTCAAGCAGCCGTACCAAGAAGGCCACAGCCGGTGCAACCCCGGCAG
CCACCAAGGATGCAACTACTGGTGCGAAGTCTTCCAAGGCTGCCAAGCAGGATCAATCCAAACAGAAGGCAGTGGTTGCTGTTAGCAGCTCCAAGGAAAT
CAGAGTACAAGCAGAAATCGAGAAGAATCGCGCCGAGGCGGACGTAGACCGTGGCAACgagagctcgtcgtcctcttcgtcttcgtcgtcttcctcctct
tcgtcgtcatcttcctcttcgtcgtcttcatcttcgggATCATCTCGCTTGTCAGTGTCTAGTAGTTTATCTGACGATGGCACGTGGGGTGATTAGAAAG
CCGAGTCAAACCGGAAGAACCGAGCCGAAACAAAAGTTTTCGCTTAATTTTTAATGCAACCATCGTGCTCGGTTCTCAAATCGcattctgctgctccttc
ttcacatTTCTTTCCTTCACTTCTGCCACAGGCTTCTCCGCCCAGATCCTCGCCGACTTCTTCCCTAATTCGAAAAGTTGATCCAACACCTCAATCTCCG
GTGGGATCAGAGCAAAGCGTGCCAACTGCATAATTGTAAAGGGGAAGTCTGGGTCGATGGACGGACTAATCTCATAGTCCTTGCGGCGTAACATGTGTGC
GTGGAAGGCACACACCTTGGTGTATCCCGGAACGTCCGGCACTAAAGTGATGAGGCCTCCGTCCACATGGTACTCCCCTCGAAACACCGACGTCCCTCGT
TTGGCCAAGTACCAAGGTACATAGCACGATGCAATGAGTGCGTCGCACAGATCGTCCGTCGAGTGGAAATCGTCCGTGAGCACCAACGCTCTAGCAGGCC
ACATCTTCTCCGTTGCGATCGTGAGTCTCTGCGCCAACGTCTCCACCGGCTGATCGCCGAATTTGGCGTGGAAGATGACGCGCAATCGCTCCTCGAGCTT
CCAGACGGTGCCATGGCTGTGACACAGTCTGGCCATAGCTTTAGTCTCTTCGTGGATGTCGCTCATACTGGCGTTGGCAGCCAAACTCAAGGCAGTGATG
GCTCCCCCTGAAGCTCCGGCgaacttggagctggactGGATGAAGCCGGCATCTTGCAGCCCCTGCGCCACCCCCAAGTGATACGGGATTAGGAACCCGC
AGCcactgaagctgaagttgtg