Description :
From Genome Similarity Track
Location :
scaffold_1845:521- 2382
Transcript NameFunction/comments
Pl_100294hypothetical protein PHYSODRAFT_518156

Sequence
1861 bases(100 bases per row)
CATCTTCATCCTGGCCCTGGCACTTATCCTACAGACGATGTGTATCTTTCTGATGCTTCAAAAGCACAATGTCCTTGCAGATCGAGCCGAACTGCTTTTG
GTGGAAGACTTGGCTGATGCTGTGGCATCTCCAAACTTCGATAGAGTGCGAGATACACATGAGCTGGTACATTTGCGTTTGTTGCGTCATTTGTTCCTCA
GTCGATTTCAGTTGCCGCAGTTATTTCCATTTGCCAAGTACCTACGGCAGGCACAAAACAACCAGATCACACACATGACTGACGTGGATGCACCAATGTG
GGCGCTGCTGCTGGCCGTGGCTTGGTTGTTGGAAGGGATCACTACAGCTTTAAATTTTGGTGAACCCGTGTTGCCAAGACCCCACGGTCTCGTGGTGGTG
TTGATAGGATTTTCCTGGGTGCTGTTTGGGCTTCACGTCGTCGTTTTTGCTTACTTCCTTTCGTGTGTTCATCAAATTTTAAAAGCTGCTGGAATGTCAG
CAGACAAACACACGTTGGAGAACCACCTCAGGTCCATTATGTGTGAAGAAGCGCGGGCATGGACACAAGAGGACGCAGGCAGAGCACTTTTGGTCATGCA
AAAGGTGCAGGAGGAGTACGAATCGCCGAGACTAGTGAACCACGGGTATTCAAAAAGCAAGAAGCACATTGTGGCGTCTGCGACGACTCCAGTGATCGAA
ATTCGCTGGTTTTCAAGGAAATCGTGGCACTTCATGGTGATGATGCTGTTAATGCTCAATGGCTTTTATCTCGCGCTGGTAGTGCAGTGCGTGGTCTATC
AGTTTGGGGTCATTTACGCTGACTGGAGGCTTCTGGAGGTGATAGTTATTCCTCTGCCTCTAGCTCTAAATACTTTCCTACTGCAGCCGCAGATATTCAG
AAACTTTGTCCTAGTTAGCAGCATTTTTCGTGTGGATAGTGTTACGCTGAGCGAGGTTGTAAATCATTTTCGTGAGATCATAGAGCTGCGCTCAGAATTC
GCAAGCTTATTGTGGGAGAAAATGCAGGCAAAGAAACTATCGATTGGAGATCTGCAGGCGGAACTAGAGTCTCATGATCCGAATCAGTCTGGCAACATCG
ATGTGGAGTTGATGCGAGTTGTGCTGCGAGGTTTCGGTTTGCATTTGTCCAAATTCAGATTTAACAGCGTTGTCAAACTCTTGTTCGAGCTCAAGGAAAT
GCAAATTGAATATACCCAGCTGCTCAAGCTGGTTGCTATAGCCCATAGCGCGGAGCTAAACAAACACGCTGACACAGAACAATCGACGCATCATCACCCG
CTACTTTTGCAGAGCGTCTTAAGTGAAGAGGTTGAGGATGGCTTCGTTTTCGCATGTGAACCATCTTATATGCCCCCGCCTCTAGCAGCGACTTCTGCGC
TGCTTACTTCACCAGTATCAACCAATTATTGTGTGGATGAGAGAGTAGCAGCAGCTCGCACCGTCACCAACGTGTCGTTTGTGCCCACAAGACCTCAATT
GAAGCGGAATGACAAGTTTCAAAGAATGAGTTCTCGGACTCTCTCCGACCTCTTTCACATTGAAAGCGCACATGATCTTGCTCAAACTACGCCTGATAGA
CCTTCGCTAATGTGTAGTTGTTCTATCTCACAGCATTTACAAGACTATTGCCTTTAACGCACCTTCACAACGTACATCCAATATCTTCCTACTATTTTCA
TTACGACTCGACTCGGGTGCACAAGAGTAAGAAGTTGGTATCGCTTTGATAGAACACAATGTGGACAATTACATCACGTTTCAACTCAAGCACAACAACG
ATGACCACGAGAAGTGTCAGCAACTCGTCGTACCCGATCCCAACAGCGCTTCAGGTACTAC