Description :
From Genome Similarity Track
Location :
contig_28:520888- 526162
Transcript NameFunction/comments
g6999.t1hypothetical protein

Sequence
5274 bases(100 bases per row)
CGAGCTGCTGCAGGGGAAGTTCGGCTTCCAGCGCAGCAGCGTGGCCAACCAGAAGGAGAATTTGGGCTGCTGGATCACCAACTACCAGATGCGCGTGCGC
GCCGAGGCCCCGCAAGGTGCCGCCGAGAGCAGCGACTTCGTGACGCGCACCGCGCTCGCCCGCGTGCACAAAAAGTTCTTCAAGAACTACGTGGCTTGGT
GTAAGTTCCTCCGCGCGCCACCGCGCTGCTGCGACCCAGAGAAGGACGCCACAGCCAAGACGGAGAAGGAGCTGGTGTTGTTCTTGCTGCTCTGGGGGGA
GGCCGGCAATTTGCGCTTCATGCCCGAGTGCGTGTGCTTCCTGTACCATAATATGGCCAAGAAGTTGGACTTCCTGGACACGCTGCAGGACGTGGACGAG
GGTTTCTACCTCAACGAGATTGTGCGCCCCGTGTACGGCGTGATTGCCAAGATGCGTACAGCCACGGCACCCAAGGGCGAGCGTCCGTTCGACCACCAAG
ACACGACCAATTATGACGATATCAACGAGTTCTTTTGGACAGATAAATGCCTCGAAAGCGACGAGATGAACGTCGCGAAAATGCTGGAAGTGCACGACCC
CAAGACGTTCAAGGAGAAGCGCAGCGTGTTCAACCCCGTGTTGGCGTTCTTTAGGGTCTGGTACTTTTTGGTTGTGGTCTTTCACGTCCTCGTGGTGGTC
ACGTACGTGGCGTACATGGCCGAGGGCGACGACGACGGAGGCCTGGGCTTCTTTTTCCGCATCTTTGACAGCGGCCAGAACAAGATCCGCGCACACGCGT
TCTACACCATTTTCATCACCGTCACGGGCCTGCTGGCCATGAAGGTGGTGATGCAGATCTGGCTCTTCGGCCTGAGACTCTACAAGGACGTGTGGATGGC
CGTCGGCGTCTTCTGCAGGCTGTTCTGGCACACGCTCTTCTTCGCGCTGTTCATGGCGGTCAACTTTTCGCCGGACGGGTCGGCGGTGCTGGGATCTCTG
AGCAGCATTTTGCCAGGAGGAGGCACTGCCGGAACGTACTTGTCCATGGGGCTGATGTACATACTGATTTACTGCATTCCGGTGTTGCTGGCGGCCACGA
TCCGCGCGTTCTTCCCGAACGCGATTTGGGGAATTCGCATTGTGAACGCGCTGGATGGTACCAGCCGACAGTATGTGGGACGCGACACGGCGCAACCCTG
GAAGGACTACTCAAGGTACTCGATGTCGTGGTACATCATCTTCTTCTGCAAGTTCCTGTTCGCGCTGCAGTTCATGATCCGGCCGTTGATGGCGCCGTCG
ATTGAGATTTATGATATCACTGTCGATGACGATGGCGTCTTCCAATCGGGGCACAACATCATATTCATCATCGCGCTGTGGGCCCCCATCTTCGTCGTGT
ACATGTACGACTCGCAGATTTGGTTTATCCTGTATCAGTCCCTTGTTGGGCTCGTGATGGGAAAACGCATGCACCTTGGCCACTACGTGGGATTGGCCCA
ACTAAAGAAGGGAATGTCGGGGGCACCGAAGCTCTTTGATGAGAAGGTGGTGTCTCTTAAAACCAAGACGCCCAACCCGGAAGCAGTGACGCCTGTCCCT
GGCGGTGGTGATGCTGGAGAGCTCCGCCACCGCGACGTTGTGCGCCTTCGTTTCGCGATCATTTGGAACCAGGTGGTGATAATTTCCGCTTGAATGATCT
GCTCGACGATCGTGAGACTGTTATCTTGCAGTACCGTATCCTGGACAAGGGTGAGCGGATCCAGGAGCCGATCTTCCTGCTGGCTGGCAAGTTGTCAAAG
GCTGTCGATGTTGCAGCCAAGTCGCGTTCTAGCAAGTGGGACACCGCAACTTTAGTCAAAAACATCGCTACTGCAGACGCCCTGGAAGGCATGAAAATGG
GCTGGAGCTTGTTCGAGATATCTTCTATTTGCTGCTTGGTGAGGACGAGAAGGGTGCGCTAGAAGTGCTCGAGTATATCTACTCGTCGCCGGACGTCGTG
AGCCTGGTCGACATGACCTACTTGCCTCAGCTTGCGGATAACATGGTCGAGCTTCTTGCCGTGATCTTGGATATGCCGGAAGATATTTCGGCGATCGACA
CACTGGAGTCTACACCCGAGGAACTGCGCATGGAACTCCACGTGCAAGTCGCGCAAGTGGTTGACCGCCTGCGCGCCATTGCGCTGACACTAGAGCTGAT
GCTGAACGATGATACCGTCTCGCGCAAAGTGCACAACTGCCGCTTCTTGCAGACCACGGCCGACCTCGAGTTCCAGACCCAGCAATTGATATACCTCTAC
AAGGCTGATGCTATGGCTGAAACTGGTCTGATCGCTGTTCACCCACGGGAGGGACCTGCTACGCCACCACAGCGCTTTAACCCGGAGGATTTCATTTCTA
GCTGCACGCGCTTATTCTTCTTGCTCCGCTTGGATGTTGCGAGTTCGCTTCCTCGTTGTGAGGATGCCAAGCGTCGCATGGGTTTCTTCCTCCACTCGCT
GGCGATGGAGATGCCCCGTGTGGACTCGATGGAAGCCATGCCATCATTCTCCGTGATGACTCCGTACTACTCTGAAACCGTATTGTTCACTTTGGACGAG
CTGAACGACCCTGTACACTCCAACCCGCTGTTCGCAGAGCTCGAGAAGAAGCAGAAGGCCAAGGGCTGGACGGAGCTGACGATCATGAAGTATCTGATCA
CGTTCCACGCTGAGGAGTGGAGTAACTTTCTGGAAAGAATGGGTGCTACCTCGCTGGATGAGGCTCTTGAAATCAATCCGACCGAAGTGCGGCTGTGGGC
TTCGATGCGAGGCCAGACGCTTGCCCGAACAGTTCACGGCATGATGCTGTACGAAGACGCCATCCGCCTTTTACGTTGGCTCGAGGTGTATTCTCTCCGT
GATATGAGTATCCAAGATAAGCTGGAGGAGATGAACCGCATTTCTGCACTGAAATTCTCCTACATCACGGGTTGCCAGATTTACTCCAAGCAGGTTGCGA
ACGGTGACCCTCGTGCGGCAGATATCGACTACTTGATGAAGTTCCCGAGCTGGCGCGTCAGCTTTGTGGACTCTATAACGGAAAAAGACGGCGACAAGGA
AATCAACCGCTTTGACTGTGTGCTCGTTAAGGCCGAAGAGGGAGAAATTGTTGAAGTCTACCGTTACGAACTGCCTGGTAACCCGATTCTGGGCGAGGGT
AAGCCCGAAAACCAGAACGTGGCATTGCCATTTACGCGTGGTGAGTACTTGCAAACGATTGATATGAACCAGGAGCACTACTTGGAGGAGTGCCTAAAGA
TGCCCAACTTCCTGGCGACTGCTACGAGCACCGGTGAGGAAGTGACTGTGATCGGTATGAAGGAGCACGTCTTCACGGGCCGTGCTTCATCGCTGGCGCG
TTTCATGACGCTCCAGGAATTGGTGTTCGTGACGCTGACCCAGCGTGTGCTGGCTAAGCCGCTTCGTTCGCGCATGCACTACGGCCACCCCGATGTGTTC
GAGAAGTCTTTCGTTGTACAAGCGGCGGTGTGTCCAAGGCTAGTAAGGGTATCAACTTGTCGGAAGATGTGTTCAGTGGCTACAACGTCACTCTTCGTGG
CGGCTTGGTGACTCATGTTGAGTTCATGCAGTGTGGCAAGGGTCGTGATGTGACGCTGAGTCAGATCAATGCGTTCGAAGCGAAGCTGTCCAATGGTTGT
GCTGAGAGTTGTCTGAGTCGTGAGGGTCACCGCCTGACCAACGCATTGGATTTCTCGCGCTTGAATTCGATGTTCTACGGTCACTTTGGTTTCTACATCT
GCAATGCCCTCACGGTGTTATGCGTGTACGTGTACGCGTACTGCAAGCTGTACGTTGCAACACACTCTGAGGTGGAGATCACGGCTATCATGAAAACGGG
CAGTCTCGACTCGCTTGCTAGTGTGATGACGACGCAGTATCTGCTCCAGTTCGGCATGCTGACCACGCTTCCTCTATTCGCGACTCTGTTTGTTGAGTTT
GGCTTCAAACAAGCCTCCCTGAAGGTGATTGAGTTGGTTTCGACTCTCGGCATTGTGTTTTACGTCTTCTTGACGGGCACGAAGGCTCACTTCTACGACG
TGGCACTTATTCGCGGTGGTTCGAAGTATCGAGGTACTGGCCGTGGTTTTCGATCACGCGTGACCCGATGGTGAACTTCTTCAAGGAGTATGGTGTTTCC
CACTTCCGCAAGGCTGTCGAGCTAATCGGTGTGATGATTTTATTCGGAATCTACGGCTCGTTCAACATCGGATCTGATGCGCGTGACGAGTACTGCGCGA
CAGCGGACTTCGATTGCGATACCGACCCGGACTTGATCCCTGCCAACATCACGTCGCTTGCAGCTTTCAGCACCACGTCTCAGAGCTACGGAATTGCTCA
TTTGCTGTGTTGTTCCTGGGTGCGTGTTGGTTGATGGCACCCTTCGTTTTCAACACGGATGGCCTGGTTCTCCAAAAGTCCAGGGTGGATATCGCCAACT
GGTTCGCGTGGATGATGCGATCGCGCCACAAGGAAGACGGAACCGACGAACACACTAGCAAGGACGCAAGCAGTGCTGCTTTGCAGCCGAAGGATGGATG
GGACGATTGGTGGAAGTCGGACGTGGACTTAATGGTGCCTCTGGGTGGAATGGGCCGGCTTACGTATTGCATTCGTGAGCTGCGTCACCCATTGGCTATG
TACTACGTCTTCCTGACGGAGTTTACACTCCCGTGGCTTGCACTGCTGTTCGGCGCGATGGGTGCTACGTGGGTGCTGCTCTGGTTCGGAAACCGCGTGC
ACCACTGCGTCTCGAAGCACCGCAAGCTGAATTCGCTCGCGATCCAAGGAATCTTGTACATGATCTGCGTCATTGGAGGCATCCTTCTGGTGCCGCTGAT
TATTGGGGCCATGGGCGGTTGGTCTGTGCAGAAGTGCTTCACGTTCTCCATTTCGATGTTCTTGGGCTTCAACTCGGTCGTACAGTACGCCATGGCGTTC
AACGGTGCTTTCGGAATGGAAGTGGCTATGTGGAGCCCCATCATGGCGCTCGGCTTCCTCATGGACATGATTGTCGGCCTGTTCCTGGTTATCCCGCTGT
TCCTGCTGTCGCTGCTGCCGTTCATGCGTATCCTCCAGACACGTGCCATGTACAACGGAGGCTTCTCGCGTGCACTGAGCTCTGGCTCGGAGGTGGCGGC
TTCGTTGGTCATCCTGCTTGGTTTGCTGGGTGGCTTCATCCACGGCTTCATGACGTCATTCCTGTTCACGCTCG