Description :
From Genome Similarity Track
Location :
Scaffold_47:52084- 54078
Transcript NameFunction/comments
Phyke_g2398hypothetical protein PHYSODRAFT_556064
Phyke_g2399hypothetical protein PHYSODRAFT_556064

Sequence
1994 bases(100 bases per row)
AGCCACCCAGCAGTCCCCCAGGAAACGTGAACATGCCCGACTGCGAGAAGTGTGACCAATTGTTGCTAAGTAAACCCCATCCGATGCCCACCAACAAGAT
CCCCGAGCACTGTAGTAGCACGTTATTAATTTAGTTAGTTAGAGTGTTTTTGGGGTGGTGTCGTCGAGAGATCGAGGAGTTTACCATGAACCACTGGAAG
ATGATTCCATCTATCAAAACGTTTAGAATAAGATACGCAGTCAGTTCGTGTGTTTTTAATGTGCATGTAGCAGAAGCACACGCACCATAAGTGTCGTAAG
TCTTGGCGGGCACGTAGCATGTGCCGTAGAAGAAAATGGCCACAAATGCAGCCGCGTAGCCGAACACAATCTGTTCGTCCATGTTGGACAACTTGTTGCC
AGTGCGACGAGTCGCAAAATGAATTAAAATCTGACTGTTCGCTGCAGGTTGAACACATTTCTGCTGTACGAAATTCCGCAGTCTTTATTGGATAAGGCTT
GCTTGAATAccgcgctgcagctgcaatgcGTGGTGGCGTGAGCACCACAGCCAAGTGACAGACTTGAAGTTGCATATGGCGTTCCTAGGCTGACAGTCGA
GGGTAGGCAGTGTATCGGATAGCAAGAGTTTATTACGGATAGTTCGTAATTTCACTCCAACATCCAGAAATGGATTCCCGGTGAGCGCTGCTCTACAGTC
AGTCTTGACATGGGGGTGTGCCCTAGACTCTTGCTGCAAACTGTGCGATTCAGATTGACTGACTTCCTCCCCTTCACCCACTGAGTCACCCGTCATTGAT
GTACCGCCACTAGCAACACATCATGTGCTACCGATCGTCTCGAAATGGCTGGCATCGCTGCTATATCGATAAGCAGATTCAGTAGTAGCGGGCTCGATAT
CTAACATCCTGTAGTTTATTTGAGGCTATCTGCGAGGAGGTACAGCGGCATCATGCCGAACTCTGCCACGTTTTCGCAGGGCAAAATATTGGAACACAGG
AACACAGGAACACAGGAACGTTTGAACGCTCAATGGTAGAGCGATTCTTGCTACACTACGATCAAGTATCCTCGTTGCaacagccagcagctcgtaaAAG
ACCACGAATAATAGAGCAGAAGGTTTGTGCAGTTCAACAGCGCTGACTTGATCATGCAAGCATATCGGGCTGCATGACTAGTatcacctcatgtaatgCA
GACAATATCATACAGAATAGCATAACTCGTGCGAAGTGCTGCAACTTGGTTGAGAATGGTGTGATGCATCGCCGCTTGCCACCAGGGCTCCAGGGCGAGG
AGATCTGTTGCTAGTGAGTGGCAAAACGGCTGGTTTGTGTGGCGTACACATGATCACACCatccagcttcaactgcgTCACATTCCTGCCACCAATTATA
TATTTTTTCGAACAATTGTCCGTGCGACATGACATGACTTTCTCATTTGGGAGGCGTGGGGAGATCCATTATCGTATCAACCAAGGAGCCAGATGGACGA
GCAGCTAGTGCTGGGCTACGCCGCTGCGCTCgtcgccgtcttcttcttcggcacATGCTACGTGCCTGCCAAGACCTACGACACTTACGGTAAGAGACAC
CTCATCATTAAGAAAAACGACAACTAAATTCGAGAGACTAACTATCCTATTCTGCAGATGGAATCATCTTCCAGTGGTTCATGGTAAACTCCTCGATCTC
TCGACGACACCACCCCAAAAACACTCTAACTAACTAAATTAATAACGTGCTACTACAGTGCTCGGGGATTTTGATGGTGGGCATCGGATGGGGATTACTC
AGCAATAACTGGGCACAGTACTCGCAATCGGGCATGTTCACATTCCCTGAGGGTATAATGGGAGGCTCCCTCTTTGCCGTCGCCAATCTATTGATTCCTA
CTGTGGTCAATACGCTGGGACTGGGGGTGGGCTTCATGTTCTGGAACGCCACCAATATCGCATTGGGCTACTGCGTTTCTCGGCTGGGGCTATT