Description :
From Genome Similarity Track
Location :
Scaffold_9:52079- 53717
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_9-fgenesh-gene-0.5Myosin
Pytir_DAOMBR486maker-pir_contig_9-snap-gene-0.51Tenascin

Sequence
1638 bases(100 bases per row)
GTCTGTGAAGGACGCGCAGCGTGTCTGCAAAACGTGCCACGCCGTGTTCAAGATGCGCACTGCGCAGAAAGAGTCCAAGTCGGGCTTCATGGCGCGTGTA
CTAGGCTACGAGTGGGATGAGGTCCAGGCCTCTTAGAGGACCTGGCGATCTAGTGATTGTCAAGTCCAGAGTGTATCTATCAACGGTATTTGTGTGGGTC
TTGCTATATTAAATGGATCATCGCGGCGGCTGCTTCCACTTGCTACCGCAGCTTACACGAGAGTGCTTGCGAGGTGCGCGAGAGACAAACGATAGAGCCA
CCCGCTTGTCGAAGAAGCGAAGAAGCGAAGCGATGTGTCGATATATTGGTTGACAAAGAGAGAGAGAGAGAGAATGAAGAATTAATACTATTGTCTTTTG
TAGATGCGCTGCGAGGGTCTTTCCGGTTTTCATTCGATTATTTTGCTGTGAGTGTTCGTGCTGACGCGGTTTCTCTTTATCCTTGAATCAGCAAGTTCTT
GGCGAGCGGATCCTCTACTGGCGTGACGTATCCGCAGTCTTCGCGCAGTCCGATGGCGCTCAGTCCGTTGCTGCTGATCATACCATCGAAGCACGCGCAT
TGTCCGTTGGCGTAGTTGCAGACGCCGCTGTTGCGGAACAAGCAAGGAAGAATTAAGTGAATTTGATGCAAACGAACAGCACGCGAGTGATGTACAAGAT
AGGAGAAAGAGGAGACGATTTGTACCACGACGTACTTGTTGGAGCACTCGACATTCTCGACCGTGCCTCGTTTCGATGTGCCAGTGCCGTCGCAGTCGAT
GATGAAGTCGGGGACCAGCGCCGCGTTCGCCCCGAAATCCACCCGAAGCGGAGGGAGGTCGCCGAGCGCTGAGATGAACTCGATCGTGATCTTGTTGCTG
CCCATCAGCGTGCACGCCGTCGTGCCACTCGAGTACGTCACGCGGACGAATCCGACGGCTCTCACTGCGCTCAGCGCATTCTGGAGGTTCAGCGCCGAGA
TGTCGGACGCCAGCAGCTGCGTGCTTTCCCCGCGGAAGATCAGCGTGAAGCTCGTGACCTGCGTGTGGCGGCAGACGATGGTCTGCACCTCGCGCATCTG
GCCCGTGGTGCGCGGGTCGTCGCCGCGAGGGCACGACCGCAGCGAGCAGTCGTAGCCTTCGAAGCCCGGGTCACACATACACCCCTGGATCTTGTCGAAG
TCCCAGGTCTTTGGGTTGTTAGGCGTGCTACCATAGGTGATCGCGAGCGGCTCGCCGTTGTTGCGCGCTTCGAGCGCCAGCTCGGCCATCGTCATGCATC
GGCCATTGCCATTGCACGGGTTGTCCAACCCAGGGCACTTCATGCGCTCGCAGGCAGCACCTTCAAATGGCGCGGGGCACACGCATTCACCCTTGGAGTT
GTCGCAGACGCCAACTCCGGAGCAGATCGCGCGCGAGTGGGCTCGGTTGTCGGAGATTGGCAGATCGAACCACGCGATGCCCTTGGGACAGGTGCGGATC
GAGCAGTCCCCGGACGCCCAACCGTTCACGCAAAAGCAGCGGAACTGCGGTGCGCCGGAGCAGTACCCGTGCCCGCTGCATGCGATCTCCCCGGGACACG
AGATGATCGTGAGCTCCGGTGCGCCGCAGTCACCGCGA