Description :
From Genome Similarity Track
Location :
contig_147:52074- 55153
Sequence
3079 bases(100 bases per row)
ATTCACGCACTGCAATATGTTTTCCGAACACTACGGCGAGCAGGTCTCCTGTTCTTGGAAGACGATGTGGCTGATCGTCATGTTTTGCTGAGCTTCGAGG
CAGCGTTGAAGCCAGCGCTTCTCCAGCTACTAGAAGGTGAGTTAGAGAGCACGACAGTTGAACGACCGACTAATTGTGCTGTTGCTCTTGCCCAGGTCGC
TTGCAAAGTCGATCTATTGCTGAACTTGCAGATGCAGTACTGGCCCAGGAGCGGTTTAAGTGTATCCCTTTGCAGTGGATTGAGACTGGCCTCGAGAAGC
TTCTGATGACTCATTTAGTAGCTCAAAGAGAGGAAACGCAATTATTTTGTATCAACGACGAGTAAATGCAGCTCGACTACGGACGGAACTCTTCACGTAG
TAGCCGCCTCCAAGTAGTAGACCCACGGTGGAAGATCCTTCAGCTGAGGACACGACACGAAGAGTTTGCCTGTCTCGCTGACTCCACTTTGTGCCTTTTC
ACCTCTTGCTGACGTTGTGGTATTGTCTACCTTCACCGTGATTGTTTTAGATGACTTGGCAGGTATTGACAGCGACGTTGTCGATAGGACAAACCGAGGG
TTGTCCACCATGACCTCGAAGTCTTTCGCCGTCGAGAATACGTTTTTAAACTCGATGTCTTTAGATGTCGAGAAGACGTAGGGGCCTTGAGGCAGCGGCG
GCACAGACACCCCTTGAAGGGTACATTTGTACTCGCCGACACTGTTTGAAAAGAGTGTAAGTGTATCTCGGAACTCGCCGATCGCTTCGGGTTCGAACTT
GGTAACGATTGATTCAGGTTTCCCTTCCCATGAAGATGACCCCTCAACCTTGCACGTTCCGGCCACGGTAAATGACGTCGGATCTTGGACGGAGCACGAT
AGTTCTGCTGCAGCGTTAGCGTAGCATGTGAACGTGAAGGTCTTAGCTTGAGAGCCACCCAAGGATGTCTTGAAGTACAAGATGCGTTCAGGACCGACAG
GTTGAGTACTTTGCACCAGATTGTACGTGTACTCGCCGAGCTCCACAAAGCTAATGGTTAGTCGATCTTCGACGGGTGTCTCGGAGTGCAGTGTGGGTCG
GTACTCAATCTCATAGGATCCCTCCGATCGTCCACTGATCTCGTTTAGTTGACGCACACGGATAGAAGGGCTGGAGCACTTCCACCAGTTAACTTTGTCC
ACAAAATTGATCTGGCGCTGGGGGTCGAACGGGTTTTCGATGGCCACCGTCTTCTTAACTGATTGCCGCACAGGAGCCTCGAAGTATAACGTGTCCACGT
CAACAGCCTTTGAAACAGCCACCTGAACGTCGTGTGCAAGGTACTCACCACTCTCCTGGTTCACCAATCGGACACTTAAACCCACCGTTCCTTCCGTGTA
GCAGAAGAACTTCATCTTGTAGCTGCGCGATGCACTCGCGTGCAGTAGAATCGACGACGGCCCTTGTACGACGACGGACTCATTTCCTGGTGGCTTCTGG
ATATCGACAGCAAACGATTGGGCTGTCTTGAGCCAGTTCCTGATCGGAATCGACATTGACAAGGTCTTCTTCGCAGCAGTAGAGAGCGAGATTGCAGCAG
CAGGTAGTGGAGCTGATGCCTTGCCAAATACATTGTACAGCAACGCACTCCCGTCAGGTATAGCGAGGAAAACGGATCCTTTGTGGACCGCGGGGCGTTG
CGAGTCGATTTCTTCCTGGGAGTTTTGCTTCGTCATGACCAACGGAGAGTACAGCACGTCGAGGTTAGCCTTGCCATGGGCTGGAACTAGAACGTTCTCT
GGGCACGACCAGTGATCGCCTTGCACAACCGGGAACAGGTTCCACGGAGAAGCAGTCGTGTTCTCAAGCACAATTGCTTTGTGGGTCTCCTGTCGAACCG
GAGAATCGAAATTGACGTCTTGGATGGACGATGTCGCCTGCGGAACACACGACCCCACCAGTGTCAATGTAGCGGGAGCAGTTCCCTCGATCATGCACGT
AACTCGATCGTAGCGAATGTCTGGATTCACGGCGGCTGGTTTGAAGGCCACCTCGATTATTTTGTGCTGGTTTGGTGCCACAATACCTTCCGAAGGGGAA
ATCAAGAAGTCTGGAGCAAAGTCGCGGACGTTCCATTGAAACTTGGTGGGAATGTCTCCGCGATTTTGTAAGCGTATTTTTCTCACGAGCTGACTGCCCA
AGCACACTGCTCCATAGGAAAGGGTGTCAGTCTCCAACACCACCTCAATACCTTGACAACATCCCGACAATACCAGCAGTTTCTTTGTGCTTCCCCCAAC
ACGGATAAGTACCTCTTTCTGAAAGCTTGGGATTCGTTGTGTCGGCGCAAAGCGGAACTCGAGGTCTGCACTCTCCTTGGCTCGAAGCGAGATTTCGTGC
CGAGGAAAGACCGAGATACCCAACGCATCGAGCGATGCGACGCCTTGTTGCAGCGAGTCCACACATTCCACCACTGTCTTCCGCTTCGAGCGGTTTGCGA
TCTTGACTGTCCGAGAGGTTTGCTGGCCTATCTGCAAATTTCCGAGGACAACCATCTGCATGGATGAGTTCACTAGCTCCACTTTAGGGAACACGCCTTC
TCCACGGACGCTAATGTTTATAGTAGACGAACCGTTGACGGTGAACGGAACTACATCAAGATACGCAACTTCGTGCCGGGCGGTAAACACGATCGGGATA
TTAACCGTCTCTCGTGGGCCAAGCACAGTAGGAGGGCAATCTACACGTAGGTGGGGCTTCTTTTCAAACAAACAATCGAGATCAATTCCACTTTCAGGAT
CCATGTTGAACACTGTAAGTGTAGCTGTTTCTGCCATAGGAGCGGAGTCGTTTTCTGCGATGAAGCACGGACCAAAGTCGTGGGACGTAAACGAGAATTG
CAGCATCGGAGGAACTGCGTTGCCTTGTAGTGCTACCACATAATTGCGGGAGCCTGCAACGGTACAGATCGCTTGCATTCCATCAAGGGATGCTTGCTTT
GTTGGAGCGAAAATTAGCTTGCATGTAGTCTTGTCGTTCTTTTTGATCGTGCCTTGCGTCGGCTCAATAGAGAAGGCTG