Description :
From Genome Similarity Track
Location :
contig_147:52070- 55148
Transcript NameFunction/comments
g14333.t1hypothetical protein

Sequence
3078 bases(100 bases per row)
TTCACGCACTGCAATATGTTTTCCGAACACTACGGCGAGCAGGTCTCCTGTTCTTGGAAGACGATGTGGCTGATCGTCATGTTTTGCTGAGCTTCGAGGC
AGCGTTGAAGCCAGCGCTTCTCCAGCTACTAGAAGGTGAGTTAGAGAGCACGACAGTTGAACGACCGACTAATTGTGCTGTTGCTCTTGCCCAGGTCGCT
TGCAAAGTCGATCTATTGCTGAACTTGCAGATGCAGTACTGGCCCAGGAGCGGTTTAAGTGTATCCCTTTGCAGTGGATTGAGACTGGCCTCGAGAAGCT
TCTGATGACTCATTTAGTAGCTCAAAGAGAGGAAACGCAATTATTTTGTATCAACGACGAGTAAATGCAGCTCGACTACGGACGGAACTCTTCACGTAGT
AGCCGCCTCCAAGTAGTAGACCCACGGTGGAAGATCCTTCAGCTGAGGACACGACACGAAGAGTTTGCCTGTCTCGCTGACTCCACTTTGTGCCTTTTCA
CCTCTTGCTGACGTTGTGGTATTGTCTACCTTCACCGTGATTGTTTTAGATGACTTGGCAGGTATTGACAGCGACGTTGTCGATAGGACAAACCGAGGGT
TGTCCACCATGACCTCGAAGTCTTTCGCCGTCGAGAATACGTTTTTAAACTCGATGTCTTTAGATGTCGAGAAGACGTAGGGGCCTTGAGGCAGCGGCGG
CACAGACACCCCTTGAAGGGTACATTTGTACTCGCCGACACTGTTTGAAAAGAGTGTAAGTGTATCTCGGAACTCGCCGATCGCTTCGGGTTCGAACTTG
GTAACGATTGATTCAGGTTTCCCTTCCCATGAAGATGACCCCTCAACCTTGCACGTTCCGGCCACGGTAAATGACGTCGGATCTTGGACGGAGCACGATA
GTTCTGCTGCAGCGTTAGCGTAGCATGTGAACGTGAAGGTCTTAGCTTGAGAGCCACCCAAGGATGTCTTGAAGTACAAGATGCGTTCAGGACCGACAGG
TTGAGTACTTTGCACCAGATTGTACGTGTACTCGCCGAGCTCCACAAAGCTAATGGTTAGTCGATCTTCGACGGGTGTCTCGGAGTGCAGTGTGGGTCGG
TACTCAATCTCATAGGATCCCTCCGATCGTCCACTGATCTCGTTTAGTTGACGCACACGGATAGAAGGGCTGGAGCACTTCCACCAGTTAACTTTGTCCA
CAAAATTGATCTGGCGCTGGGGGTCGAACGGGTTTTCGATGGCCACCGTCTTCTTAACTGATTGCCGCACAGGAGCCTCGAAGTATAACGTGTCCACGTC
AACAGCCTTTGAAACAGCCACCTGAACGTCGTGTGCAAGGTACTCACCACTCTCCTGGTTCACCAATCGGACACTTAAACCCACCGTTCCTTCCGTGTAG
CAGAAGAACTTCATCTTGTAGCTGCGCGATGCACTCGCGTGCAGTAGAATCGACGACGGCCCTTGTACGACGACGGACTCATTTCCTGGTGGCTTCTGGA
TATCGACAGCAAACGATTGGGCTGTCTTGAGCCAGTTCCTGATCGGAATCGACATTGACAAGGTCTTCTTCGCAGCAGTAGAGAGCGAGATTGCAGCAGC
AGGTAGTGGAGCTGATGCCTTGCCAAATACATTGTACAGCAACGCACTCCCGTCAGGTATAGCGAGGAAAACGGATCCTTTGTGGACCGCGGGGCGTTGC
GAGTCGATTTCTTCCTGGGAGTTTTGCTTCGTCATGACCAACGGAGAGTACAGCACGTCGAGGTTAGCCTTGCCATGGGCTGGAACTAGAACGTTCTCTG
GGCACGACCAGTGATCGCCTTGCACAACCGGGAACAGGTTCCACGGAGAAGCAGTCGTGTTCTCAAGCACAATTGCTTTGTGGGTCTCCTGTCGAACCGG
AGAATCGAAATTGACGTCTTGGATGGACGATGTCGCCTGCGGAACACACGACCCCACCAGTGTCAATGTAGCGGGAGCAGTTCCCTCGATCATGCACGTA
ACTCGATCGTAGCGAATGTCTGGATTCACGGCGGCTGGTTTGAAGGCCACCTCGATTATTTTGTGCTGGTTTGGTGCCACAATACCTTCCGAAGGGGAAA
TCAAGAAGTCTGGAGCAAAGTCGCGGACGTTCCATTGAAACTTGGTGGGAATGTCTCCGCGATTTTGTAAGCGTATTTTTCTCACGAGCTGACTGCCCAA
GCACACTGCTCCATAGGAAAGGGTGTCAGTCTCCAACACCACCTCAATACCTTGACAACATCCCGACAATACCAGCAGTTTCTTTGTGCTTCCCCCAACA
CGGATAAGTACCTCTTTCTGAAAGCTTGGGATTCGTTGTGTCGGCGCAAAGCGGAACTCGAGGTCTGCACTCTCCTTGGCTCGAAGCGAGATTTCGTGCC
GAGGAAAGACCGAGATACCCAACGCATCGAGCGATGCGACGCCTTGTTGCAGCGAGTCCACACATTCCACCACTGTCTTCCGCTTCGAGCGGTTTGCGAT
CTTGACTGTCCGAGAGGTTTGCTGGCCTATCTGCAAATTTCCGAGGACAACCATCTGCATGGATGAGTTCACTAGCTCCACTTTAGGGAACACGCCTTCT
CCACGGACGCTAATGTTTATAGTAGACGAACCGTTGACGGTGAACGGAACTACATCAAGATACGCAACTTCGTGCCGGGCGGTAAACACGATCGGGATAT
TAACCGTCTCTCGTGGGCCAAGCACAGTAGGAGGGCAATCTACACGTAGGTGGGGCTTCTTTTCAAACAAACAATCGAGATCAATTCCACTTTCAGGATC
CATGTTGAACACTGTAAGTGTAGCTGTTTCTGCCATAGGAGCGGAGTCGTTTTCTGCGATGAAGCACGGACCAAAGTCGTGGGACGTAAACGAGAATTGC
AGCATCGGAGGAACTGCGTTGCCTTGTAGTGCTACCACATAATTGCGGGAGCCTGCAACGGTACAGATCGCTTGCATTCCATCAAGGGATGCTTGCTTTG
TTGGAGCGAAAATTAGCTTGCATGTAGTCTTGTCGTTCTTTTTGATCGTGCCTTGCGTCGGCTCAATAGAGAAGGCTG