Description :
From Genome Similarity Track
Location :
scaffold_12:520616- 522029
Transcript NameFunction/comments
Plaha_PHALS_13276nadph:adrenodoxin oxidoreductase

Sequence
1413 bases(100 bases per row)
CGTCGCCGCGTCTGCATAGTTGGATCAGGACCGAGTGGTTTTTATACCACCAAATACCTTCTCAAAGAACACGCAAGCATATGTGTTGACATGCTAGAGA
TGCTACCAACTCCGTTTGGTCTCGTACGTTTCGGTGTAGCACCTGATCATCCCGAAGTaaagagtgtaatgaatgaATTTAATAAAGTGGCATCCGATAC
ACGATTTCGCTTCCTAGGGAATGTATGTGTGGGTGAAGATGTGACGTTGAGCGAATTGCAGCAACATTACCACGCTATTGTCTTGGCTTACGGTGCGGCA
GGAGATCGTCAACTGAATATCCCTGGCGAGAATCTGAATGGTGTGATGTCAGCACGTAGTTTTGTTAATTGGTATAATGGGCATCCATCATTTTGTAATT
TGAAGTTGGATCTGACCCAAATTGAGACGGCAGTCGTTATTGGTCACGGTAATGTGGGTGTAGACTGTGCACGTTTGCTTACAAAGAATGTGGAAGAACT
CGCTAGTACAGATATTGCTGATTATGCGATAGAAGCTTTACGGAAAAGCAAAATTCGAAATGTTGTGATTATTGGGCGACGTGGTAGTACTCAGGCAGCA
TTTACAATGAAGGAGCTTCGAGAATTGACTAAGCTAGATGGTGTTAAGTGTGTTGTAGATCCCGAAGACTTAAGACGCAGTATAACACCTGCGTCAGAGC
AGGAAATGAGAGATCAGCGTGGTCGTAAGCGTATGAATGACGTATTAAACATGGCAGCTGAGCACTTTGATACAGCTATTGACACTAAACGCGTTGTCCA
GATCAAATTTCTGAGCTTACCGATAGAATTTCTAGCAGATGAGAGTGATCCGATGCGTGTTGGGGCAATTCGAGTCGAAAAAACAAAGCTTGAGGGGAAA
GCGAACCAACAGCGAGCAGTAGGAACTGGAGACTTTGAGGTCATTCCGTGTGGTCTTGTGCTGCGCAGTATTGGCTACAAGTCAGAACCAATTGACATGG
CCATTCCTTTTGATACCAGTCGTGACGTGATAGCGAATGACCAAGGACGCGTTGTCACTTATAGTGACGGAAAGTCACATCCTATTGTTGGATTATACTG
CACCGGATGGGTAAAGCGTGGTCCGACGGGTATAATTGGCACCAATATCATGGATGCACGAGAGACAGTGAGCTGTATTCTTGACGACTTTGCTACTGGT
AAATGTCTGAATAGTTCTGACAAAGACTTAAAAGGACTAGAGGCGGTAGAATCGCTGATCAAGAAGCGCAATCCAGACAAGCAAGTCGTTCGATGGGCAG
ACTACGAACGTGTAAACACTGAGGAGAAGCGTCGAGGTGAAATGGTTGGCAAACCTCGTGAGAAGATCACGTCTGTGGATGAGATGCTCGAGATCGTGAA
AAGTGGCTACTAA