Description :
From Genome Similarity Track
Location :
Scaffold_251:52052- 54799
Sequence
2747 bases(100 bases per row)
CGACCTACCCTCGGTTCTACCTCCAGATAGAGGTTTCTGTCATGAAATTGACTTGGTTCCTGGGATCAAATACTGTGTCTTACGAGAGTAACTCTTACCT
AAGGAGAAATGTGATGTCATTGATGACTTCTTCCCTGCCAAGCACGAGGCAGGAATGGTACATGAGAGTAAATCTCCACATTCGCCACCGACATTTTGTG
TCAAAAAGCCGAACGGTAAGTAGCGTATTGTGCATGCTTATAACAAGCTTAATGCGGCCTCTATTCCGGCACAGACACCCATTCCTCAAAAGGATGTTCT
CCAAAACAACATGGTTGGTTGTGCTATGTATAGCGCACTCGAGTTGGTCGATGGATATTATCAATTGCTCATGCTATCGAGTGATATTCCGCTTACAGCA
GTGAGCACTCCGAGTGGTATGCTATGGGAATGGCTAGTGATGCCCCAAGGGCTGTCTAATGCTCCGGCTATATTTAATCGTCTGGTGATGCAACTTTTCC
GCCCACATCGGAATTACGCACATATGTACTTTGATGACATTTTTGTCCATAGTCGTGCAACAGACGGTCGGTCAGATGTTGACAATCATATCAGAAATTC
GCGAGCCGTGCTCGAGTGTATAGCGCGCAAATAAATTGTACGACAACGCGTCTAAATGCATTTTGGTGTAGGAGAGATTTCTTCTCTAGGATGTTTCATT
GGTAATCGCGGCCTCAGAGTGGGTCCTGCTAAGCCTAATTCTATAGTGAACTGGACGATTCATAAGAATAAAAAAGACTTGCATAATTGGCTTGGCCTTG
CCAATTACTTACACAAATACAGTGAAAATTACGCTGCTACGGCTCGGACATTAATTGATCTCCTTAAAAGGGACGCAGATTGGCTCTGGGACAACACCCA
TGCTGACGCAATTCGGGCAACCAAGGAGAGTCTCCTCCATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTTTTAGCGTTGTCTGCAATGCATCT
GACTTTTCCATAGGCAGCACTCTGTTACAAACAGATTCTGCAGGCCGCGAGCGAGTTATCACATTTATATCTCGTCAGCTGAAAACTTCTGAAAATCACT
ATCCAGTTTGTGACAAAGAGATACTTGCTATGAAGTATGCTCTCGTCAAATTTTGAGTCCATCGTCTTGGCTCCGAGCCTTCTTTGTCTACACAAATCAT
GCGTCATTACGTACGGCGACACAGTCACCTCACCTCTCTTAGAAAATGGCTCGGTGGCTTTCCTTCTTTGCGGAATATAACTTCGAGGTGAAGAATAAGC
CAGCCAAACAAAATGTGTTTGCAGATGCCCTCTTTCGCCGACCTGATGATGAGCTTGCTCATGTCACGACTTTTTCGTCTCATTTTGAGGAGCTCATTCG
TGTGGCATATCCGCGGGATCCTCAATGTCTGGCATTGTTGCATGCCCTTGGGAGTGAGGAATACAAGAACTCGGACTGTCAATTATCGGCACGCTTGCGG
GCCAGCCTGCATCGATATTCCATCGATAATGGTCGCTTGTGCTATCGCACAGACGTAGCGGATACCGTTCGCATTGTTGTGCCTCACAATGAGGATTTAA
AGTACCGAATCCTCTTTGAGTCCCACGATACTGCCCTCAGTGGGCATTTGGGCTGAAAAAAGACTTATGGGAGGTGTGAGTCAACACTAATGGTGGCCCA
AACCCTACAAATGGGTGAGCACATACGTGCGTACATGCGACACGTGCCAGCGAGTAAAACCCTCGGCACATTCGGCTGCGCCACTCGCCAGTTTACCCGT
GCCCACGGGTTCTTGGGAGCCCATCAGTATGGATTTTTGTTTGGTCTTCCCAAAGACTGTGAAGAGAATATGGGAATTGTGGTCTTTGTTGACCGCTTAA
GCAAGATGGCTCACTTTTTTATCGGTAGTGCCGGATTCCATCGATAGCAAAGGTACAACTATGGTGTTTATCGATCGTGTGTTTCGTCAACACGGGTGGC
CGCTGACAATCATCTATAATCGCGACCCTCGCTTCACTGGCAAGTTTTGAGCTTCCATCTTTAAGGTGCTTACCAAGCGATTAGACATGTCCACAGCGGA
CCATCCGCAGACCGATGATTAGACTGAGCGAGTTAATCGCGTCATTGGCGACGTTCTTCGTAGGCATTGTGCTAAGTCGCCTAAGACTTGGAGCTCGATG
CTCCCTGCCATTGAGTTTGCGCTGAACAACGCTGTTCATGCCTCGAACGGCTTTACTTCATTCTATGTGAATAGATTCACGCACCCCCACGTTCCGCTCA
CGTTACCACTCCGTGATTCTGGGCTTGGTGGGGGAGTGTCTGCTGACAAGTTTGCTGAAATCAGCCCTACCACGATGCAGAAAGAAGTGAGCAAGTTTCT
CACGACGCGCTTTAGTATCTTACGACGTGTGCGTGATGCAATGGCTGATAGCTAAGACAAAAAAAAAGAACAAGCTGATGCTAAAGGCAGAGGATGTATT
GATTCCTATGAAGCTGGAGATCAAGTCTTATTAAATGCTGAAACCTACCTACAAATGTAGTGTCTGCGGTCTTCAAGACGAAATTGCGTCCGCGCTTCAT
TGGGCCGTTTACGATCATAGCGAAGAAAGGCTTTGCCAATACACTCAATCTCCCGCGCAAGTTGTGCACACAACCAGTGTTTTACCCTGGCTTGCTTAAG
CCATATCATGGTCCTTCTCTCGTGGACCGGAAGGCGCTTGCGCCTGG