Description :
From Genome Similarity Track
Location :
Scaffold_264:5205- 9635
Transcript NameFunction/comments
Phyag_g4083conserved hypothetical protein
Phyag_g4084hypothetical protein PHYSODRAFT_471750
Phyag_g4085hypothetical protein PHYSODRAFT_553002

Sequence
4430 bases(100 bases per row)
TGGTCTGCACATCGGTACCTTCCAATGCCTTGGGATAGAAATCAATCATGTCGGCGTTAAGAAACGCGATGGCGCCCCATACCAGCTGAATCTGAGCTGA
TCCACGCTGCGGGTCCACGGAGAGAATGTGTCCGGCGCCGAACTTGGTGATCACGGGCTGCCCCTGGTAGTATTTGCTCGTTACGAACGTGTACGATGTC
GTCGCAatgttcttgagcagcgtcaaccctgcagcacctggagcagcagctccactaACACTCGCCATTCTAGAACGACTACGCCTCGAGTCCCAATCCG
CACTGCTGCCTTCCGACATGCCGCGCgggcgtcgctgctgctccgagGCGCGTCCATTCGAATTGTTGTCTGCCACTCGGACATCTGAaggacggagctg
cagttcataCTCTCCAAGACCACCACCTGCTTTCAATCGCAGCGTGTACAGCTGCTCACGGATATCGTACTTCAACACGCGTCCGGATCCCGACGGCGTG
AACACTCGCTCCCCAATAAGTGCCGGCACgacctccgtcttctccagctctgtCACATTGAGGAATAACAGCCCAGAAGCTTGCAATTCAATGGCGGCGA
TCCCGTCATCGTCTCTGATCGCAACGATTCTACCGAGTCCGAAAGGTGTCGCCACGCGAGAGCCCGCTGTCTTTGCGAGTAGATCTCGTCCCGAGACGCC
GTCCACGCTACGAGAATGGGTCTTGCGAGTATTGGGCGTTTTAGGGCGGGGTTTGGCCAGAAACAGCTTTGACGACGTGTTGAGCCCCGCACGTGCAAAG
GAGTAGACAGCTTTGAGTGCAGGACGCGTAGGAGTCGTCTCggcgtcgctctcgctctcggGCTGCGTGTCCAGACGCGCCTTGCGCGGCGGCACAGACG
CAGCCGGGCAAGACTGGTTTCGACGCAAGTAGGGCGCTGCAGACTGGCTGGACTCGGCGCTCTCGGTCTCCgacacgtcgtcgctcgagtcgtCCATctc
ggaggtggcggtgggGGCTCGCCGCGCTttggtcttcttggagaCGGCGTTGGCGGGCTTCCACGCCAACATAtcggacagcgacgccagcatcGTATCA
ATCAATTAGTGTTGTGAAGTATTGGTGTATTGCTCTCTGCCTCTCTGCGTGCAATGGCGAAGTGCGGGAGGATGccgcaagaagatggagaatgCTCTTG
AGTCTGGAGTTACTGGACGCCGCGTCTGCCGCTTTGGCCTGGTTTTGCGGCAAAGGAAGGTGGGAACAAAAGAGAGCTGCGCCTTTGCCTCGGCGCGAAA
CTGCGTGTCGATGGCCGGGGCGGAGAATCGGAGAATGGCTGCGACGGCGCGGACAGATGGGCTCAGCAGGAAGGGCGCGCACGAGCCCACCCCACGTTAC
ATGTGTACGCGTTGCTTCATATTCATGCAAGAAGCTCGCCATTTTTTCAGCGAGAAGAACCGTTACGGCCGAGCGCTGCGTTATCCACGACGCTTCGCCG
AACCATACAAATGGCCATACAAACACTGATCTGAACGGAGACCTAGCCACCACACAAAGATCCATTAGCTTTTCAACTGCCGGGCGTCTTCAATTGTTGT
TGCaccgagagcagcacaatGCACTGCGCGCGATCGACTGCCATCGCAGACATCGCAGTCTCTCAGACGTGGCCAAGCGAACTGGTTCCGGGCATGACTC
TCCTGGCCGTTGTCGCCCTGCGTATGCACGTCGTGCGTCAGCGTCTGGAGAACTCCGTCGCCACTCGATAATAGCGCGTGCGTGTGCGATGCCTGGCGCC
ACTGGGCGGAGAACGCATGTGGCTCCGCGACAACTCGACGCTTCAAGCATACTAGTAACTGCACAACGCGCTGCTTCGCGCCGCACGACAATATCCAGCC
GTTCGCTTGCGCGATGtgagtgtagccatgttgagCAACAAGGTGCGTCCCGGCACCGAACTTATCTTTGGTCGTACTTATACGAATCCATACGGTTCTT
ATCCCAATTATCAGCGAATCAAAACGTGGCGTCTTGTCTACGCACGTGCACCATCACTCACAAGAAGAGTGGTGGTACCCCTCTATACAAGGAACAGTTG
ATCCCGTCTAGCGAGGGATGGCATCGCTTGCAAGCTGCAACACAACCCACACATCAAGCACCATCGAGGTTACCCACGTCCTTATTACGTCACGCTACGC
TGCGTTGCAGGCCTTGCCTTGGGCGGCTCTTGTCTAATAACTCTGATAATAATTACACGATgagtgctggaggacgagcgTGGGACAGAGCGGgccacag
cgccgccgccgtggcgCCCCCGACGTCCGTTAAGCTGCACGACGTGATGGACGCGGAGTTGgcggccaagctgcagcgcgaggagcaggagcagtgGGAG
CGCGAGATGGAAGGCCGCTTCGGAGGCGACGACCGCCAGACCGGCTGGTGCTTCGTGGAGGTGccgagctccagctccggcCACGGCGTCATGAGCGTCA
TCCAGCaggaggtgacggtggaggatgcgcacaaggacgacgacgacccggACTACACTTTCGccctggagctgcaggcccAAGAGGCCGAAGAGTACGA
CCGCATGCGGCGTCAAGAGGCCTCATCCATGGAGCGCGTCCGAGTGATTCAACAGGAGGACCCGAAGCGGGAGGAGGTCCGGCAAACGTTGCAACGGTAC
TACGACCGAGAAGCGCATCGGGAGTTCGACCCGGTTGATGCTCATACGGTGCATCATAGTCCTGAAGCGAGATCGGTTGCTTCTGTTACTACAGTTGCTG
CTAAACCGACATTGTCGGTCGCACGACCTCAAGTCAGGGATCCGGACGTCATTCACGATGTCTACTTGGACGGAGGATGGCGAGTGCCTAAAAAGCACTC
GGCTATGAGGCACTCGGACAGGAAGAACCGCCACCGGCccaagaactcgtcgtcgagtgGTGGTACGCCGAGCAATCGGATCTGAACGATGGCAGCTAAA
AGGACGACGCTGCGAGTTGTTTGCTGGCGTTGTCCATTATCAGCTCTGTTCAACGGAGCCGGGCGACGAGAAAGAAGTTTTGgattcttctcgtcgtcct
cacACAGGTAATATTAGTCTATAAGTAATTCTCCACCCAGCGCGAGGTGTCCACCAGGAAGCACCAAGCCAGTGAGCCAGCGTCGTTGTTCAATGGATAG
TAAAGTGCCGTTGCCGTCCAAGTTGAACAGGTCCTTTGACAAGCATCAACTTTTGCAGACCCTGTCCAATCCGATCGCATAACATTTATGCGTTTGGACG
GGGGTTCGAGTTGCCACCAACCAGAGGAGCTCATTTCCCCCGAGCCGAgccacgtccagcgcgtccctctctgctgctgctcaccgACTGCATACGTACA
CAACACCAGCCTCTTCATCACCGTGTGGAGACTCTCGCAACGCCGATGATCCGCacgtcgccagcgccaggaggagacgaccacgacgagtGGGAGCACA
CGGCCGACCACGCTGCCAGCAATAACGCTGCGATCCCCGGCTCAATCTCCATAGCTGCCGGACCTCAGGCTTCCGACAACGTAGAGGACGCCACACGAGC
CATGCAAAGTCTGCGCATCTTGCagccgcctccagcagcgtcggaCGATGGTGGGAATTATCCGCAGCCTGTAGGAACCGCTACTGCCAGCGCCCACGGC
CCATTGGACCCCGTACTCGTTGCAGGACTGGAGAACGCTCGAGAGAGGATGACGCTGCTCAAATTTGAAGATCAGATCGTGAGGTTTTTGAGGAATTCAC
GCGAGCCACAGCTGAAGTTCCCGCCGTTGTCTTCGTACCACCGACTGGTGGTGCATCGCTTGGCGCAACGCTGCAGACTGGAGCACCAGACGGCGGACTA
CAATCCGTACGAGAACAGCTCGGCGCGTGTGGTGACGCTGTTCAAGACGGCGCAGTCGGCGGTGCCTCGTGTGCTGCTCATTGATCTGTCGACTGATCGA
CAGACGCCACCGGTGACGCCCGCTTCAGCTCCGAGAATTATGATGCGTAAACGTAGTGCGCCGCGACCAGGAGCTAATGGAGGACGGAGTGGTGGTGCGG
ATAAAGCCACGCCTACTTTACAGGACCGTGAACGTGCATACGCAGAGGCGCGTGCACGAATTTTTGGTGAAGATACAGCTAGTACAGCTGCTGAATCAgt
gtcgtcttcgtctccatcgtcgaccTCGTCGACGCATGAAGGCAATGGAAACGTACCTGGAAGCGGCAATAGCGGAGTCAGACATAGAAGCCGACAGGCA
GCAGGACCGGATGGCAGCAGAGGTTTTGGTCGAGGTCGAGGTAGTGCAAGTTCTGGTGGTAGTGCTAGTGCACCTCAGTCTCGGGAGTCTCGCTCGCCGA
AGGAGCGATCGAGCAGTAATGATGGAGTTG