Description :
From Genome Similarity Track
Location :
Scaffold_1005:5205- 9471
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1005-snap-gene-0.2Calmodulin-binding transcription activator
Pytul_var.sporangiiferummaker-pug3_contig_1005-snap-gene-0.3Conserved gene of unknown function

Sequence
4266 bases(100 bases per row)
CGATTCACCGCTCGCTGCAGATCCGGCCCCCGAGTAGGTGTCGTTTGCCGAGAGGAATCATGTCTACCTTCATATTGTCCATGATTTGCTCATAATAATG
TGTGTGGTTTGGATGTGCTGTTTGGGCAATTTCGGTAGGCGGGTGTTTGCTCTTGTATGATACGATGGCGGTCCCGGATTACAAGAAAGACGGGTGGCGG
TGGCAGAAGCGAAAGGACCATTCCGGGAGGGTATGCGTGGACATGCTGACTCAGGCGGTGGAATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTT
GATGAACTTGCGCAATGGACTACAATGTAGGTGCGAGAAGACCGCGCGAAACTGCCGATCAATCGCCAAGTGATCGTGTTAGGCACCTACGTGCATTCGT
CCGAGATTGCGGTATTTGAATTGCTTGGAGAATACGATTTGGAAAGTGGATGTGTTGGTTTAAAATGGCATGAGTTTTTGTGGTCTTGTGCTGGTGTGCA
GACTTTTCACCGACGAAGTTACATGCTGCGAGACTCTGACCAGCATGTCGTGCTCGTTCACTACTTTGACGAAGTCAATAAAGCCACGAGCACAACCAGT
CACATTCGCAGCAGCAATGTGGATTCATCAGTGAGAAAATTGGACGGATTAACAAAGGGAATGAAGCGCTCGCTACCAGTGTCCACCGTGCTAGCTCCGA
CTATCATTCCACCGTCTTATCCACTCAAGCCAACGGTGAAGCCGGATGAAAGCGTCGATACGATTATGAACGGTAAGTGCCCTTTGTTTATATTTGCCAG
CAAGTTGTTGCATTGCTGAATCTCCAATTTGGTTGTATCTAGATTGCTTCGAGTTGGACTACATGCAGCACATATCGAGGCATCAGCAGCAGCGGGTACC
GAGCCCGACGACTGGGGAAAGCGATTTCGAGTTCTTGAAGAGCGCTGACATGGGCACACTGTCTGGGTTTGATGATGAGTTACTGTATCCAGAGATCTCG
TCGCGTTACGACTCCAACGTTCGCTTGCCAAGTGTTTCGAAGATATCGCCAGCTCACATCTCCGACTTTTCTCCAGACTGGGATTTCACCGATGGCGGTG
CAAAGATATTGATCTGTTTGGCGTCTCCGCTTCCGCAGCCTGCGGTGATGAGTCAAGGCGCAAAGCTTTTCGTGCAGTTTGGAATCCTTAATCGCGCTCC
AGCAGAGAAAATTTCCGAGACAGTGGTGAGATGCACAGGTGAGTAGGAAAGGATTGGAGGTATCTGGTGCAAGAGGCGAGTACTAAACGAGTGTGGATGA
TAATATTGCTTGCATGCTAGCACCGCCATGGAGTCGTACTGGGACTGTGGAAATATATGTATGCTGCTGCCAAGATAGACTTCAACCAGACTCTATTCAG
CTATCTGACCGAAGAACATTCACGTACAAGACGCATCAGCAAGCATCCCCATCGCTGGTTTCCACCGCTTCAGACCAAAATAGTGCCGTGATCGAGCAGA
ACAAACTGTCTTTAGACCCGGTATCCGCAGTTGACACTGTCTCGGCGAATGGGACTGGTAAGCGACGCAGTCGATCCCCACAAGTGCTCGAGAGAAGGCC
ATTGACAGGGCCAAGTGACAAAAAGCGTAATGCACGAGCGTTCGAAACTTCGAATTTATCGTCTTTCGTAGACACAGACTGTAAGTTTTGTGCTTCACTA
GTGGTGTATGCTTTGGAGGGCAGGTGTCTAATTGCAACCTTTGCTTTTTCTTTCAGTGGATGAACGGCAGTGCAAGATTCGCGTTGTCGAGCGCCTCTCT
GAGTTCCACCATGCCATTTGGACAACAGCGTCGCCAGCGGAACTTCTTGGTGTTCCGAATGGTAGCACCTTTTTGCCAAAGACCAACGCTACCAGCGAGA
CAGAAATGATGGGTCAACCAGAGAATCCTTCTGATAGGAATAGGGATCGAGAGCAACCGCTCGATGATTTAATGTTGGGCGACTCGGCTACGACTGCTTT
ACTTGGTCTGGATGACTCTGCCATTGAGACTCTCAGCGACAAAGATTTGGAGCAACTATCAGAGAAGCTCCTCGAGCGTGTGGTTCGGCAACTGGTAACA
CTAGCCCACACCAGTGAAGAGCTGCTTGACGAGTTGAACTCACTTGATGAGGCCGGATTGAGTTTGCTCCACTATGTGAGCTTCTACAACTACTCGCAGT
TGGTGCCACTGCTTCTATCGCACGGAGCGCAGATAAACCAGCAAAGCACGCAAGGGCAGACTGCGCTTCACTTAGCTGCTGGGTGCGGTCATACAGGTGT
TGTGGAGGTGCTCGTTCAATCTGGTGCCGACTTGTTTGCAGTTGACTTTGATGGCTTCACCGCAGCGGATCGAGCAGAGAAGTCAGGACATTTGGAAGCA
GCCACCAATTTAAGACGGCTCATGGGCAACCACGAGACCGAGTTCATTGGCGACCTTGCGTCCAATGGAGGCTTTGATATGGACATTGATTTTGGTATTG
ATCACCTGGTGGAGGCTAACGATCCTAGCAGCCAAACTGATGAAGATGTGTCTCATCTGAGCATTTGTGAGAGTCCAGCAGAGCCGGGTGGTGGTGCGAG
ATCGAAGCATTATGTAAGTGCAGCTTCTTTGCTTCCGTTTGCGTTTGAAATTGTATTGTGCTGACAGCGGGATTTTTTTGCAGGTCGGAGAAAACCAGGA
GCACAATCGAAAGCTTCTTCTCGGTGCATTTTCCACAATGAGTTTGCATGACAAGTGTGCCCTCTCCTTGAGCATCTCGAGGGATTCCAGCACGAATGGC
AGTCGGCGTCGTGGGAGTAGTATTGGTGACGACACGTTCCTAGCGTTCAGTGTTGGGAGTCTCACACCAAGCTCCTCACCTGCACCAGACAACGATTTGT
CAACGGGTAATGAATCTAATCTGTCCCTGGAAAATGATTCGCTGGGTGATTCGGATGTCAAAAGCGTCATTGCGGACGACGAAGAGAACTTGACAAAGTT
AGAGGCTGCAATGGAGCTGATGGGTCCAGAGGAACGGCAATCTCTGGAAGACGAAGTGAAAGTCCTTCAGCACAATATCCGAGCGTGGCTGTTGAGACGA
AATTGTAAGAACATGCGAGAAACAACAAAGCGGCTTCACGAAGCTACCAAAACCATTCAAGACCAACAGAAGCAGCAGGAGCAACTGAAAGAAGCTAGTG
AGCGTGAAACTATGCAGCAAAACGAGATGTCCGAGCGCGAACGCGCTGCTGTCACTGTTCAAGCTGCCACTCGAAGCATGCTCGCTCGGAAAAGCTTTCT
GCAAACGAAAAACGTGACGATCAAAGTTCAAGCTGCGACGCGGGGCGTCTTGTGTCGCAAGAACTTTGCGCGCATGAAAACGCATGCGTTGGCGTCGTTG
GTGATCCAGAGGAACGTTCGGGAGTGGTGGCACAAGCAGCCTGGAGCCCTGAAACCCGTGCAAGAAATCGACGCGGCCAAATCCGACCAGGAGGAGGTCC
GGACGGATCCAATGACGATGACGGCGCTAAACTCCAACAAATCCCTAACTAAACGGAGTAGTTAGCAAAAGAAAAGCGCGGTGCAATTGCATGGCGTAGC
TGTCGGCGTGAGATGCATTGGTAGTGAGTGAACAGCAACTGCTCGGCATTTTCTCCTCTCTATTATCAAACCGTTCGTTTGCACCCATACTAAACTCCAC
GCTGCGATGTCTGTGTGTGTTGTCTTCATGCTGGATCTGTTTGCTGCTATATTCACGAACCACTTTGTTTATTCGGTGTCTTCGTCCGTGTATCGTCGGA
AGCCTTCGATCGGTGGCGTCCACGTCGCAAAGCCGCGCTCTTCCGGCACCGGCGAGAGATCCAGCTCCAGCGCCTCCTGCTGCAGGTGCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCCCACTTGAGGTCGATCTTGGTCTGGATGTCGCGCATGAAGTGGTTGTGCTCGATCGTCGACAATACGTTGAACCGACG
GCNNNNNNNNNNNNNNNNNNCTTGTCCTCCTCAGACCACGGCTCACTGCATGCAATAAGCGCACACCAGTTAACACAACACATCAGCAACGGAATGTGAA
GCATCAACGCAATTATGGTGCAGCAAAGCGCAAAACGCAAACGTACGCTTCTGGGTATCGGCCCTTGACGTTGCGCAGCATCAGCTCAAAGTTGGCATCC
TCGCCGCCCTTCTTGCTGCCCTTCTTGGCCGCCTTCTTGCCCTTGGCCGCCGCGAACCCGCGCGTG