Description :
From Genome Similarity Track
Location :
Scaffold_944:5205- 6756
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_944-fgenesh-gene-0.0Transmembrane protein

Sequence
1551 bases(100 bases per row)
CCAAGCGGCACGCGTCGCTGCGTCCCGACACGGCGGCGCGTGTCAACCTCTTCGCGCGCGGCAACGTCGGGCTGCTGGTCAACTACGCAGCGGTCGGCGT
CGTGCACGGTCTGCTGCAGGCGCTCGTGTACCCGTTCCTGAACGTCTACCTCAACATGGACGACTACCTGGCGTACTCGGCCGAGCGGTGGCTGGCGCTG
CCCTGGCTGCTCAAGTTCTTCGTGGCAGTGGCGTCCGACTGTCTTCCCGTCCGTGGATCGAGGAGGAAGGCGTACATGCTGATCGGTTGGGCTTGGTGTC
TGCTCTTCTCGCTGGTGATCGCAGCCCTACCAGCAGAGACGCCGTACCTGCAAGACGGCGCAGTCGCCAACGGTGACGCCGCTTCGGCTGGAGGGAAGTA
CGTCGGACTGTTTATGATGGTTGCGTTGGGCTACGTGGTCGCGGATGTCGCGGCCGACGGCATGATGGTCGAGTTCGTGCACCTCCAGCCGGACGCGATC
AGCCGCACGCGCATTGTCACGACCGTCAGCAGCGTGCGCTTCCTCGCGCAGTTCGTCGTCATGTTCTTCGCGGCCTTCATGTGCAGCAGCGACTCATATG
GCGGCTCGTTCGCGTGGGGTGCGTCCGTGAACGGCATGATGGTGCTGGCAGTGCTGACGTCGGCAGCTGCATTGGGTGCCACCTGGTACTTCCTCGCCGA
AGACACTGTGGTGCAGGGTGTTCCTATCCTCGACGCCCCTCGTGCGCTGTGGGGTCTCGCGAAGCAGCGCGTCGTGCTTCAGCTCGTGGTGTACGCGTTC
GTCACGCGCGTATGCTTCACGTACTACGCGTCGACGTCCAAGGCAATCTACGAGTACTGGGCTCCAGCCACGGCGCTCACAATCAGCTTGTTTGCCAGTC
TCCACGCCGCCTGCACGGCTGGTGCGGCCATGCTGCTGCAGCTCGTGCCTTGGCTGCAAGAGATGAGCTGGCGCCGCGTCGTCTCGCTCGCCGTCGTGGC
GTCCGTGCTCATCACGCTCATCATCGCGCTCTTCACGGTCTTCAACGTCGTGCGGAGCGCGGCACTCACATTGATCTTCGAGCAACTGGCAGCCGTGCTC
GAAGCCCTCGCCTTCTTCGTGCTGCTCTTCGCGGCCACCGAGGTCGCTGAGCCTGGACTCGAGTGCGCGTCGCTCAACCTCGTGCTGGCTGCCGGGAATC
TCGCGGCGCCGTTCGCCATCTCGCTCTCGCAATCGGTCGGCGAGCGCTTCGACGTGTACGACTCCGAGTACGCGGCCGACTCGAGCCACGCACGCTCGCA
GGTTATGCTGTGCTTCGTCGTCATGTTCATCGTTCGGCTTCTCAACCTGGCGGCGCTCCCGCTGCTGCCAAACCATCCTGCGGCTGCGCGTGATGCCAAG
GTGTTGGGCGGGAAGGTGGGCCGGTGGCCAGTGATCGCGGTGCTTGGTGTGCTCGGCTTCATGCTGTTCTGGGCTCTTCTCATGGTCTTCCTCGCCTCGT
TCGAGCGCACGGCGTGCCTCACGGTCGCTGGCGGCGAGAGCTGCTAACCGC