Description :
From Genome Similarity Track
Location :
Scaffold_383:5204- 8338
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_383-fgenesh-gene-0.8Flagellar associated protein

Sequence
3134 bases(100 bases per row)
CGTGGCAGCGGATGGAAGACGTCGACGAGGGCGACGAATGTTGCTACGACGCGCTGGATCCGAGCCAAGACGGACAGGCAGTCGACGGCGACAAATACGA
AACTCTTGGCAAGTCAGTCGACAGCTTCGACCGCCTGGTGGACTCGGTCAAGGACAAGCTGGCGGGTCGCGGCAGCGCCAGCAAAAGCTCCAAGTATGCG
GTTGTGCGTGCCGAGACGTACGCTTCGTTTTACTAAGCGAGAGCATAGAACTCATTGTGATCTCTCACACTTCTTGTCCTACATGACGCCGTCTCCATGT
GGCGCGTCGTCCTCCTCGTAGTCGTCAAAGCCGAGAATCTTGTCGGCGAAGCTGAGCGCCGAGTACTGGCGGTCCAAGAGCTCGGCGCCGCTCGCGCCGC
CGTCGGCGCTGACCACGAGCGCCTTGAGGCAGCTCTGGAGCTCGTCCTCGCTCATCTGCTCGCCCGAGTGCAGCAGCCGTGCCTCGAGCAGCTCCCACGG
CAGCACCGGCGCCGAGTCTTCCGTGGTGTTGGCCTTCCCTCGCTGCTGTCGCCGCGCGAGCACCTCGAAGGCGCGCTCGATCTGTGCCTTGCCGACGCCG
AACACGGGCCGGTGGTTCACGTACAGCTTGAGGAACTCGGCGAGGTCGAGGCTCTCGACGGCCTGCGTCGTCTCGGTGAACTTGGAGAACTTGACCTCGC
TGCACATGTGCTGAATCTCCTGGTCGGTCGGGTAGAAGCCGATGGCGCGCATGACGTTCGGGATCTCGCGCAGCGGGATGCGGCCCGAGATGTCGCGCGC
CGCCGTCGCGTCCTCGCCCTGCACGCGGAGCTGCGCGAGGTAGAAGTAGTCGACGATCTCGTGGTAGAAGGCGCCGTCCGGGCCGCCCTCGAGCAGCGAC
AGGAACGGCGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTCCACCTCGGTATTGATTGTCGTCGGCGGCGCCATCGCCATCGCCCCCGCCGCCTC
GAGCGCGTCGAGCTGGGCCGTGTGGATCTCCCACATGTTGACCACGAGGTCGTCGACGCCCGCGGTGAGCAGGAAGCTGCCGTCGCTCGTGACGTCGACG
TTGCTGATGGCTCCCGGGTGCGCGATGAGCCCCATGGCCTTGTGCGGGTTGCCGTCCAGCGGCAGCTTGAGCAGCCCGACGACCTTGTCGTGCGTGCTGT
ACGCGCAGTAGCGCTCGCCGACCGTGGCTGCGCCGTCCAGCTCGCCACCACCACCACCGACACCAGCGCCGGGCTTGAGCGGCACGGGCACGAGCTTGTT
GATCGGGCCGCCGTAGCACGGGCCGAGCGTCGTCTTGCGGCACGTCGTGTTGCTCGCGTTCCACTGCTTGAGCTTGTACTCGTCGTTGGCCACGACCACG
AGGTCCTCCTGCAGCCCGCGCATGTCCGGGTGCCAGCAGCACGCGGTGGGTACGCCGCTCTGCTCGATCCGCGTCGGCGCCTGCTTGAGCACGACGCCGT
CCAGCACACTGCATCGATCGAGCGCGTACTCGACGAGCGTGCGGTCCTCGGCGACCGAGACGAGCGCGAGGTTGCCGTCGCCGTCGCGCGAGAACTCGAG
CCCCGTGACGGGCTTGCTGTGCGCGCGGCAGCGGCCGATGAAGACCCACTCGCCGCCCGTGCCGTCGTCGCTGGCGTCGAACTTGCAGCGCCACATGCCG
AGGTACAGCGTGGCGTCGAGCGCGACGAAGAGCGAGGCGTCCGGGCTCACGCGCACGTCCGTGATGGCGGCCTTGCCGAGCCGGAAGGTGGCCAGGTCGT
CGAGCCGCTGCGCGTGCAGGATCTTGATGGCGCCGCTCGTGAAGCCGACGAACAAGCGGCGGCCGTCGGGCGAGAAGGCGAGGCACTGCGGGCGGAACTT
GTCAGCGTCGAACTTGCGCATCATGATGAGCCGCTTGCCCACGTAGTCCCAGAGCTGCAGCACGCCCGAGTACGAACTGAGCGCGAGCTGCGGGTGCAGC
GGGTGGGCCGCGAGGCCGTGGATGGCGTCGTTGATGCCCTGCATGAGCAGCGTGCCGCGCCGCTTCTCCGGCTCGTACTCGCCGAAGAGCGACGCCGTCA
TGCCGACGATGAAGGCCGAGGACGTGGCCGCGATGAAGTCTGGCACCGTGAAGCGGTCCTCGTCGTCGTTGCGGGTCGTAGGGCTTTCGTCCTCGTCCGC
GCAGGCGAACGAGACGCTCGTGACGGCGCCGGCGNNNNNNNNNNNNNNNNNNNNCATGTCCTCGAACCAAGCGACGAGCCGGAAGTCAAAGTCGAAGAAC
CGCACGGCGCCGTCGCTCGAGCCGAGCACGAGGTAGCCGTCCATGTCGGCGAGCACCGTGAGCGCCGCGGGCTTCTTGTGCTCCGAGGACCCGCCGAGCC
GCACAATCTTGACGGCCTTGCGGTCCGGGAAGAGCCCGCTCGTCGGTTCACTGGCGTTGGCATTGCCAGTGGCGTCGGCGTCGGCGGGGACGACGTCCCA
GAGCACGAGGTCGCCGTCCTCGGTGCCCGTGAGCGCCTGCGTCGAGTCCGGCACGAAGAGCGACTGCGTGAAGTTGCCCACGACCTGGCGGAAGTCTCGC
TGCGAGAGCGAGGGCGAGTAGAAGAGCAGCTTGTGGCTCGCCCAGTTCCAGAAGATGACGCGCTGCCGGCCGTTCGAGACCACCTCGCGTACGTCGTACG
TGTTGAACCGCACGGCGTGCTGCACGTCCTCGGTCGCGACCAGCGACGAGTGAAGCGCGCGGTTGCTCTGCGCGGCCGGCGCCGTCCACTCCCACACCGA
CAGCTCCTGGTCGAACCGCTTGCGCTTGCTGGCCTTGGCGCCATTGTTCGCCAGCGTTGGCTCGCGGGCCACGGCGCTGAGCGTGACGATGAAGAGCGCG
TCGGGCGAGATGTCGAGCGCCTCGACGCCGAGCGGGTGCGGCTGGAAGATGGTCTTGATCGGGTGGCCCGTGGCCGAGTCCCAGACCACGAGCATGGCCT
CGGCGCCGCGGTCCGCCGTGACGATCCAGCGCTTGTCCTCGCTCACGGCGCAGCAGCTGATCGGGTGGCAGTGGCCCTGCAGCAGCCGCTGCTGGCGGCG
CGCGAAGTCGTAGATGACGCCCGTGTGCGCCGCC