Description :
From Genome Similarity Track
Location :
Scaffold_814:5204- 6801
Transcript NameFunction/comments
Phyke_g11098conserved hypothetical protein

Sequence
1597 bases(100 bases per row)
CAACATGAGACGCGATGCGACGAGGCGCTCACGATCTTGGATGTTGGCTGCGGTGCAGGCGGCGGTTTGTGtgagctgcagttgctgtaCCCTCAGTCTC
AGATTGTGGGGGTAGATGTGTCTATCCAAGCTCTGGAACGCAGCAAGGAGGCGTGGAATCGCTTCATCACGGAGATGCCAGAGTTCCAAGCAAAGAAACT
GAGACTGTATCATCATTCCTGTGAGAGGATGAAAGGGGTGCTGACCCATTCAGTGGACGTAGTTGTTGGCGTCCAGAGCTTACAGGAGGTGAAGAATATG
GGACAAGCAGTGAATGAGATCGCTCGTGTACTCAAGCCTGGAGgtttgctgttcgtggcggACTTTATCCCGCCGGATGTAGCAGCGGATCATCTCGAGC
ACTCACTGCTATCGCCGATTTCATCGGCGCAGAACAAAACCCCATTGTTTGAGATTGTACAGGAACAATTGGTGTCGTTCGAGGCGGCGATGGGCGCAAA
ATTGAGTTCTAAAACGACAAAGGAGCTTATCCATCAGTTGACGCCCGAGGAGTTCCACACAGAGCTCGAGgcctttttcttcgtcgagAGATCGCAACTC
TACGAGTTGTTACGTCGTGACCAGATGGGATACCGATTGCTGTGTCTTCGTAAACGTGATGAATGTAGcacggacgaggaggaagaccATCGACACATGG
ACGAATGGGCGGACGATGGCGGAGTTGACTCATCCAATGAAGAGATCCAGGACGACGATATGCCAAACTACTATCCATACCAGGAATTATTCCCACAGCT
CGACATACTCAAGGACAATTATAATGTGATTTTGGAGGAAATGCAAGCCGTACAGCAGTCAGCGACGTGGCCATTCTGGCCGGAGAAACACTACTCCGAA
AACGACAGCGAGTGGCGTGTATTCCCATTCTGTTACACTTTCCCAGCCTATGATGCCACCAAGACGACATGGGTCGCCCCAACATGCGTGATGTGCCCAC
GGACCGTTGAGCTTCTCAAGACTTTACCGGGTATTCGCACGGCGCTCTTCTCGAAGCTGGGGCCGAACACGACGCTGGCTGCGCATCGCGGTTGGGCAGA
CCTGTCAAACCACATTCTGCGCTGCCATTTCCCGGTAGTGGTACCCGCTCTGTCTGACGGCTCTCCGTGCTGCGCCATGGTAGTGGGCGGCGAGACGACA
TTCCACGCTGAGCGCGAATTCATAGTCTTTgacgacagcaagttgcaCTACGCCTTCAACCATCACCCAGAGAAAACACGTCTCGTGCTTATTATCGACT
TCTATCGCCCAGACGAACTGCCAAGGGGACGTGCTCGCGGCGGCCACTCCGACGAACTGGACGACTTCATTGAAACCTTTGGCAAGAAGGCTCTGCTCGg
tgacaacagcgacgagtAGGACAAAGCAAAATGGGCGGACTGTGTCTGTGATTAATTCAAAATGCCCCGTTGTATGTTAAATAAACCGATCGACAACTAA
TGAACACCATTATTTGCATGTGACGACAATCCTCAATGGATGAGAACGATATTTGTAAACGTAGGTGGAAATCGTCGGTAGGTACCATTGTATCCAT