Description :
From Genome Similarity Track
Location :
scaffold_143:52027- 55704
Sequence
3677 bases(100 bases per row)
AAAACGACAATGTGAAGTGGAAGAAGAATTCAGCACGAGCGAAGGAGCTGATCTACGGCGGAATGACGGGTGAAATCATGAAGACAGTGAAATGTGAGCA
TGCCGCTTTCCGTGTAATTGAGATACTTAAGCAGAGATTCGTTGGGAAGACGTAATTATAGTATGCTGTTGAAATGTTCCAATTAAGACAACTTCGACTT
CAGGAGAATGGAGATGTGGCTGACCATTTGGGTGAAGTGCGTCGAATAATGGGCAGAATCGCATTGTTAGGCAAGCCATTGGAGGATTACGATAAGCCAG
CTTTGTTAATCGGTACTCTTCCACCAAATTACGAAAGTGTCGTGGAGACTTTTCTTGCAAGCCACGTATCCCGTGACATTAACGCTCCCCGAACTGAACA
ATTGGAACATGCTCTAGGAGTGGCATGGGATCGGTGACAAGGCAGAAAGTTGGCAGGAACAGCTGAAGACTCAGCGATATCTGGCAGTTCTGGTAGAGGC
TGAGGCCGAGGACGTGGTTTGGGAAATCGCGGTCGAGGTGGAGGCCGTGGACGAGGTAGATATTTTGGTAATGGCGGCAACGGGGAAACGGAGGTCGACG
TCGTGGACAGAGTAGCAGCGGATGTTTTCATTGTGGAGAAGGATCGCATCGTCTTTCAATGCCCGCACTTAGGGAAAGGCCCACCTGGTGATACCCAAAG
AGATGATCCTCAGCAGAAACAAGCAAAGTCTGGAGGAAAATTTTAAGGGAAAAAAGCTGCAGTTAAGAGCCTCTACACTGGTGACGACAGTGATGATGGT
CACAGCACTTTTGAAGCAGTCCGCAAATATTTCGAAGTTAGCTCACAAGCGTTGGAACTTGGATTCTGGAGCTACAAGTGATATTACTAACCAGGAAATT
GAGTTTGTCTCGTTCACACCGAAGAGTGCATTGGTTCGGGTTGGAGGCGAAAATGTCGCTGGAGTTGGAACAGTGAAGAAGGAAATTCAGACGTCAAGCG
GGAAGACCCACCATGATATTGCATGGCGTGTGGTATGTGCAGGAGCTTCGGTTCAGTGCGTTGGCAGATAGCACGGACACTACCGGACAATGAGAAGGTG
AAAATTCATTTTGACGATGAGACCTGTGGTGAAGTGAGGTTCCAGCGGGGAAATGCATTTGCACACGTTGATGAGACCAACCTGTATTGTTTAAAGCTGG
AATCCCCTGTGACTTTGGCCATGGTAGCAGCTTATGATAGTGATCAGAATGTGAAGCGGTGGTATACGAGACCCGGCCATTCTGAATGCAGTGTATTCAA
TGCACTGTTTCGACATGAAGACTGGCCGCTAGCTGTAGTTGATTTAAGAGTGAATGGATCATTTAGCTGCGAATCGTGCGTCAAAGGCAAGATTATGAGA
AAGAGTTTTTGCTCAACTAAACCCGCATCAAGTCGTGAGTGGTTAGTTGGAGAGAGCGTTCACGTAGATGTTCGGGGTCCATATGCAGTCGAGTCATCTT
CTGGAAAGGGATATTTTGCTCTTTTTGATGATGACACGAGTTGATTCTCAACATTGTACTTGTTGAAAGAGCGGTCTGAGATCTACGAGAAGTTTGAGTT
GTAGTATGAGAGCGTCAAGACACGGATGAGAGTGAGAATGGAATCACTGCGATCAGAGCTTGCAAGGGGCACCCGTCCGACCGTACCCGATCCGAACGGA
AAACGGATTGGTGCAGGTACCCGAACTTGATGAGACACAGTAACGGATCGGGTACGGGTACCCGAACTCCTCTGTGCATTCTTATTTGTATATCAAGCAA
GATCTCGAAATACATATCTGTGCACAATAACTGCATGCAGCCCTTGTCAATCTCCCTCACCAGTTCACTACATCTCTTGGAGTTTGGAGTTTTGGTCTGT
GAAATTTGTCTAGAGATCGCAGTCTGCGATATGACAATGCGCGTGAGCTGACATCGCTTGCGAAGTGGTGAAAGCAGAACTATGAATTTGAGGGTTCACC
CACTATAAAGCTCACTCCGGAGATATGGAGTTGCTGAGAGGATGAATCGCATAGTAACGGAGCGCATGTGCTGCTTGTTGGTATATTTTGATCTACCCCA
AGCGTTATGGGCTGAAGCTGCTGTGGCAGCTGTTTACTGCATCAACATCGTTCCGAATCTGTAGAGAGGAATGGGTGTGTCATATTCAGTGTAGTTTCGT
GAAACACCTGAATACTCTAGACTTCGGACGTTTGGCTGTGCAGTTCTGACGTACGTTGTTACGTAAGAAAATGAATCCGAAAGCACGAGAAGCGGTGTTT
GTGGGGGTACTCTCGAGAAATAAGCGGTTACCGTCTTCTCGATAGCAAGTCGAACAGGTCATTTTACAGTCACCCAGCCATCTTCTATGAAACCAAGTCA
GGACGGACTTTAATAAAACCAGAAGTACTCCAACTGCCAATGTTCCTACGTCTGAGTATTTGACATTGATGCAGCAACCATGCATAACACCCCGTCACTA
TTGAGAGAAGCTCAAGAGGATGGTAAAAATGAGAAGGAGTGCAGAACTGGTGGGGCTAATGCAGCAGGTGAGAAAAAGAAAGATCATCACTGACATATCT
GTACCAAGGAAAAACAGGAAGAAAGTGAATTCAGCAAGTACTGAACCTGGTGTGAGGAGACTCAGAGAAAGAAATGACCTACATCACCTCATAAACAGAA
AGGGAAACGTAAGCGACGGAGTGTGAAGACGATCGCAGAGTCTAAAAGTGAGGGTAATGGGCGGTGTGTGACACCGACTTCCGAGCAAGATGGGCAACAC
CGACCTTCAATCGAGGTGACTGACTAGCAGAGTCAAAGAGATCTCCTATTCTTATATTTGGTGAGACGATGACCAGCAAATTAGAGAAATCTGGAGATGA
CGGTGACTCCAACAAAGAGAGTGGGGCAATACTGGAGTCACAAGGAAAATCTGGCAAGTCCAGAAAGACTGGGAGTGTGGAGCGTCGCCCAGTGAAGACA
AGAAGCGGCAGAGTGTCCATGCCACCACCATGGTTAGGGGACACACTTCATCTGGCTTGCCGCAGTTGACTTGGGAATAATTCAGGCGGTTCACGAAGTT
GGAATGATGCAATTGACCAGATGCAGTTCGAATTGGCACAAGAGAAGGCACTTGACTGGTGGGAAGATTACATTTGCTTACTGACAAGTACGGTCACTGA
TATAAACACTCTAGAGAAAGCAATGTGCATTGAACATGCAAAAGGATGAAAAAAAGCTACAGACGCCGAGTACAAAGAATCAGTGAAGAATGGCACTTGG
GGGTTGGTACCGCGTCGGAAGGGCATGAAAGTGCTAATGAATCGCTGGCTTTTCCGAGAGAAGTATTTGACAGACAGAGAAATTGAACGATTCGAGGCCC
GCTTAGTGATAAAAGGTTATCTACTAGAGTTCGGAATTGACTACCCCGAAATTTTCTCGCGGGTGGTTCGACTAGAGACTTTGAGGGTTATCTTTACACT
TGCAGTCATTCGGGACTATGAAATAGACGAAATAAACGTCACAACGGCGTTTTTGAACGGAACCATCGACGTAGAGGGGTTCATGGAGCAACCTGAGTGC
TATGTTGTGGAAGGATAGGAGGAGTACGTGTGCTACTTACTCAAAAGTTTGTATGGCTTGAAACAAGCCCCCAGGGT