Description :
From Genome Similarity Track
Location :
Scaffold_204:52021- 57023
Sequence
5002 bases(100 bases per row)
TCGCCCGAGGAAGATACCTCGTGGTGATGGTACGGGAGGAGACGACCGACATAACATTGGATGCGTACGCATCTTGCGAGGCAACTCGATTGTGTACGTA
TTGCATTTGCGACGTAGTACACGGAACGGGCCGATGTACTTGGGTAGTAGTTTACTACTGCCCACATTAGTTACTATGTGCTTAGGTAGATTTACCGTAG
ATAGTAGGACTAAGTCTCCGACATTATACAGAAGAACGTTTGCTCTTTCATGTTTATCAGCGTTTCGTTTCTGTCGGTCCACTGTGTTAGCGATGGAGTC
TTACACGAAACGGACCACTACTTCTCTTGCTAGCAGGAAATATTCTGCTGCATCACTTTGGTCTGTTGCAGTGCGCCTTGTGCTCACCGCTAGGAGGTCA
TCCACTTCTTCAGCTAGGGTGTTCTCATCCTCGCTAGTGTAGTCATTGGCGATGCTGAATATAGTAGCATCATCATCCTCATCTGGGTCAGCAACAGTGT
CATCACTATTGATAAGGTTATCTTCTTCGATGTCGACTTGATCGACATCGGCAACGTTCGCGTCGTCTAATACTTCAACGCGTGATGAGCAAGAGCCTGA
ATGGTTTTTCGCTCGAGAGAATCCCCCGCTTTCACCAAGAGTCTCACTCTAAATGGGTGGGTAGGCGTGGATGGCGTAAGCCATTCACGAAGAATGGTGT
ACGCGTTGTCAACGCATGTTCGGAGTTATTGATCGCAACTCCACCATCGGCGAGAATTCACTCCAATTGCTGAAACGTATCCTCGAAATATCTCTTCGAG
GACGCGGTTGACGCGTTCTGTCTGACCATCAGTCTCGGGATGGTCAGAAGTGGACATAGTCAGACGTGTTTCGAGGGATCGGAACACGGATTGCCAAAAC
GTCGCCGTGAACCGTGGATCTCGATCAGAGAATAGTTCACGGGGTAGACCATGGAGTCGGAATACCGTGATAATTAATACACGGGCACAACCCTGTGCTG
AGATTGACTCATGAACTGCAGCAAGATGTACCATCTTGCTGAAACGGTCTACGAACACAAGGATACCGTTATTCTTGTGAGCGTCTTCGGGGAAACCGAA
GACGAAGTCCATTGAAACGGACTGCCAGCACTCAGCCGGGATTGGTAGAGGCTGTAGTGGCGCACGATATGAAGGACTGGGCTTCACCCGTTGGCACACT
TCACAAGCACGAATGTACTTTCGCACAAACTGATACTGGCGGGGCCAGTAAAAGTTGCGACTTACCGTGAGATAGTCTTTTCACGCCCACGATGCCCACG
AGTTGGGGCATCGTGACACTCATACGTGATGCGCAATCGCAAATAGTTATGAGCGGGGACGACGACACGAGGTGTGTCGCCGGCAACGGCTGTATAGTAT
AGCAACCCGTTGTGTGTTGTGTACCGATCTGATGAGGAACGGTACAAATCCGATAAATCTTTCAACGATTTACGAGTTGGATTCACCAGATGATCCATCA
ATCGCAGAAGATCCTTATCTTCTGCGTAGGCCTTTCTTACGTCGTCAAGTAACGTTGACGACGGGACACTGACTGTAAGTGTCGCAACAGTAGGATTCTT
CTCACTGTTGGATTGCGCGCCCGGCTCGAAATCGAGTTGCCGCGAAAGCGCATTCAGCGACGACATTTAGTCGTCCGGGTTTATACTCTACGGAGAAGTT
GTACTTCGCAAAGAAGGACAGCCACCTCGCTATCCTTTGCGAGAGGTGTGGGCTGTTTACGGCCGTGCGGAATAACGCATGGTCCGTATAGACTACAAAC
GGCCTATCTCCAAGGATATAGACGCGAAACTTCGCTAGTGCATACTTCATGGCAAGAAGTTACTTGTCATGTACTGGATGATTACCCTCAGCTGCTTGCA
GCTGACGCGATTGATAACAGACGATACGCTCTGCGCCGTCTGCATCGTACTGCATTAACGCGCAGCCGATTGAGAATTGGCTGGCGTCACAGACCACATG
GAATGGTCTGTCTTGGTCTGCAATCGCCAAGATAGGCGATTGCAGCAAGCTCTGCTTGATACCTTTAAAGGAACGCTGACAATCCGCGTTCCATGATTCC
TTCTCGTTCTTTTTCAAGAGACGAGAGAGATGAACGGTCATCTCAGCGTAGTTGCGCGAGTGCTTGTGTAAGTATGCCGTTAGACCAAGGAACTTTCGTA
GTCCCTTAACGTCGACTGGCACAGGCCAGTCGGTAATCGCCTTGATCTTTTCAGGACCAGGGCGTATGCCGTGTTACCCACGATGCACCCAAGAAGTGGT
ATTTCACTAGCCGCAAATATACACTTCTTGAGGTTGGCATACAACTTATGCTTCCGCATAAGTTGAAGAACCTGACATTCGTGTGTTCTGTGAACTTCCA
CGTCTGTCTTCCCATCCATAGCCCGGCTATGGACGAACACATCGTCAAAGTAACTCGGTGCGAAGTTCCGCACCGGTCTCAACAGATTTGTCACACATCT
GTTGAAGGTGACAGGGGCGTTACTAAGCCCTTGTGGCATTACTAGCCACTCCCACAGCATACCGATGGGGGTGCTCACTGCTGTGTACGGGATGTCCCGT
TCACGCATTAGGATCTGATAGAAGCCATCCATCATATCCATGGACGAAAAGATGGTACCCTTTGACCTACCATCAATGATTACGTCCTTCCTCGGTATCG
GCGTCTGAACCGGTACGTTGCAGCATTCAACTTGTTGAATGCGTGCACTATCCACCACCATCCTGTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGA
GGGGAAGTTGATTCCCTCACATGACCCGCAGCTAAGCCATCGGCAAAGAACTTGTCTAGCTAGTACTTGTTCACGAGGCAGTGGCCACTGCTTCATGACA
CTATACTTCGAGCCCGGTTTGAGCTCGATCTCGTGTCGAGTGCCTTTATCCTTAGGCAATTCGCATGATACGGATTCAGGTAACACATCCTTGAATTCGA
TCAAATCCTTATACAAAGGATTTGCCTGAAGCGACTCCCAAGATTGAGACGTGTATCGTTCAATCCGAGTCTTATCATCGAAGACACTTTCATCCATAGA
TGAGCTGCTGAGAACCCGTTCATTCTCAGCAAATACTGTTGCCGACCGAATGTCAGTCACGTACTCATCCTCTATGACGAGTATGCAGATCTGCTTGACC
TTGCCACTACGCAGATCACGCAATAACCGTTTCGGTTATAGCTTTGGCAATTGAGTTATCTCCGAAGTCGACTTCGGAGGTGCGATCAGATCAAGTGTAT
AAGCGCTTGATCCGTCATTAACCAAGACATTCAATGTCTCGGTTTCTTCCTGGGAACTTGTTTCCTCAAGTACGTGTGGACTTATTCCCTCGACGTCTTC
TAGCTGTGGTTGCGCTACCACAGCTATGTCCTCTACGAACGACTCTCCAGCCGATCTAGGATCATCTTGTTGCCTTGTGTGGGCAACCAGTTTGTTATTA
CTTGGATATCGCCCGCTAGGCGTACAACCATGTCCCGATCCACTCGACTTATTCGAGTGGTGGAACTTCAGCGCTGCCTGTACTCCTGTACAGCCGCCGG
GATCTTTCTCCACAATGTAGGGATCAGCTACACTGAGGTCTTGTGCAGTCGTACTAACGACCGTACCGCAAGTGAGGCCATCGCACTCACTCGCAGTACA
TCCATACGCTTGTGGACGCTCCAAGACGTTCATCAGATGGCCATCTGATGAACAAGCGGAAGGCATCTTCACGGATCGATGCTGCCAGCTCAATCTTGGC
TCGTATCTTCTGAGCCAAGGTAATCCCAGGATGACATCAAATTTTGTCATCCAGATCCAGTACGATGAAATCATCATCGTACTGTTCACCCTCTGACGTG
TAGTGGATTCCAACTACACGTTTCTCAACGGTTATCGACGTGCATGTGGCAAGGCACACCGTCATCATCGTTTGAGGGACGTCGCGCTCAACGAACTTGA
TCCTACGACCCTCTAGCGACTGACGACGAACAAAGTTGTTCGACGCCCCACAGTCGATTAGAGCACGAAGTGAAAAATCGTTTGTCACTTTTAATTCCAA
GGTGATTAGTGATACCTCATCACCAGGTGCAGAGACACACAATGATGGTGTAGCTGGAGCAACTTTCATCAAGAGATTTGCAAATTCTCTTGAGGTTGCT
GGATCAGTAGGGCGCTCCGCCCCTACTGACCCCGACCATTTTTTGACGGTCCACTTCGCTGTTGTGACTCCGCAACAGCGTCGGAACCGCGTCCGTTGCC
CTTCTTGCAGACGGTCGATCACTTCGCTCAGTGTTACGAGACACTGGGCGTGGGACACTACACTCGTACGCGTGGTGTCCCAACTTCTGGCAGCGATTTC
ACTTCTGCAATCGCTTGTTGTTTGAACAGCGAGGTCTCTCGCTCTCGACATAACACAGGTCCATTGGTTCTGGACCTCCAGTCTCTTGTCGTCTCGGTGG
ATGATAAGAACTCGAGCTAGCATGAGCCTGTCTCATGCTAAAGTCCTCCTGTTCCGCAGCTGAGATTTCTTGTTCAAGCGTATCCAACTCTAAGCGGAAC
AGGTGGTTCCTGACGGGCCCATCTGCGAGCCCTTGCATGAACACAGTAATCAAACGTGTGTTCATGTACTGGGTTAGCAACTATACTGCTCGCGAGGAGT
CGTATGTTTTGAGCGTAAGTGTACACATCACTCTTACCCTGCTTGAGTTTCAGAAGCTCTGATCGAGCCCTGAACTCAGCCCGTAGCGGCTCAAACGTCT
GTTTGAGCCGGGTTTTAAAGGCTTCCAGCGACTCAAAAGCATATGGGTCGCTCATTTCCAGCCCTAAGGCCCAAGTATTGGCACGTCCCGCCGAGTGGGT
TTGAGCAAATGTGAGTTTCATTTGCTCATTGTCGACACGTCGTGCCTTTATGGCTCTGTCTAGTTCGACGAACCATAATAACAGGGAGTCTTCCTCGACT
CC