Description :
From Genome Similarity Track
Location :
Scaffold_3:5202- 7356
Transcript NameFunction/comments
Phyta_totarag191hypothetical protein PHYSODRAFT_346079

Sequence
2154 bases(100 bases per row)
GACGGCGCCAACGACATGTGCACGCTCAATCACCTGCACGAGCCGGCCGTGCTCAAGAACTTGGAGCTACgcttcgccaagaagatgccCTACACATACA
CGGGGGCCATCTGTATCGCCGTGAACCCGTACCAGTGGCTGGACCTGTACGGCCgcgagctgtacgagcagTATCTGGAGCAGCCCCGGGACTCCCTGGC
CCCTCATCCCTTCGCCCTGTCGGCCACAGCTTACTTGGACATGAAGAGGACCCAGGTGGACCAGAGTATTCTCGTCAGCGGCGAGTCCGGCGCCGGTAAG
ACGGAAACGGTCAAGATCATGATGAACCACTTGGCCTCCATCTCCGGGGGCGGCAACCACGGCACCAAGGTGATTGACCAGGTGCTACAGTCCAACCCGC
TCCTCGAGTCGTTCGGTaacgccaagaccaagcgaAACGACAACTCGAGTCGATTCGGCAAGTTCGCTCAGCTGCAGTTCGACAACATGGGCTCACTTGT
TGGATGTCTGTGTGAGACCTACTTGCTCGAGAAGAGTCGCGTGGTTGGGCAGACGGAAGGCGAACGCAACTACCACATCTTCTACCAGATCTTCTGCTTG
CCCGAGGACCGCAGGAcggagctcaagctgagCGGCGACGTCACGAGCTACAAGTACGTGACGGAGGGCGCTGACGCTGAGCTCACTGGCATCGATGATG
TGCAGTGTCTCAAGGAGACCCAGGATGCTTTGGATACCATTGGGATCTCGACTGAGGAACAGAACGCCATCTTTGAGATTGTGGCGGCGATCCTAAACCT
CGGTGAAGTGGAGTTTGAGCCAAACGCAAAtgacagcgagaagagcCACGTGAGCAACGAGGACATTGTGGACAATGTCGGTGCTCTGCTCCGTACCCAG
AGCGCGGCTCTCCACTcaacgctgctggaacgtTCGATTACGGCCGGTTCCGAGTCGTACACGATCCCGCTGAATGCCGAGCAGGCCTCGGACCTTCGTG
ACGCGTTGGCGAAGGGTATGTAcacgcagctcttcgactGGCTGGTGCACCGTATCAACAAGGCTATTTGCTCCACGAACAACGTCAAAACGCACATCGG
TCTGCTGGATATCTTTGGTTTCGAGAGCTTCGACCAGAACGGTTTCGAGCAGCTATGCATTAACTACGCtaacgagaagctgcagcagaagtttAACAGT
GACGTGTTCAAGGATGTGCAGCAAGAGTATGTGGATGAAGGCATTCCGCTCACTCTGGTGACGTTCGAGGACAACCAGCCGATTCTAGACTTGATTGAGG
GCCGAATGGGTATCGTCGGCATGCTGAACGAGGAAGTGCTCCGCCCCCAGGCCACGGACAGCACGTTCGTGAGCAAGGTTCTGGACGCTTGCAGCGACCA
CCCAAGCATTGAGAAGAACAGAATTAACCCGCTGGAGTTCACTATCCACCACTACGCTGGTGACGTGACGTACAACGGCACGGGCTTtttggagaagaac
aaggacaCACTGCCTACGGACATGGTACAGCTGCTGTCCGGTAGCCAGAACGACGTCATCTCAGGCATCTTCACGTCCACGCAGACGAGCAAGCGCAACA
GCCGCGGCAAGAACGGAAAGGAGGGTCGCCAAAAGGGTTTCCTTGTCGGTAACACTATTGCAGGCGCCTTCCGTAAGCAGCTGTCGGAGCTGATGTTGAC
CATCAACAAGACTTCATCGCAGTACGTGCGCTGCATCAAGCCTAACGCCAACAAGAGTGCAGTGGAGTTCAACCGCCTCATGATtgtggagcagcttcgt
tgTGCTGGTGTGATTGCTGCTATTCGCATCAGTCGTGCGGCCTTCCCTAATCGTTTACCGCTcgtcgagttccagcagcgcttccagaTTATCTGCCCTT
CGGCGTTGCGCGATGCGGAACCTTCCGTAATGGTTGCTGGtctgctgaaggagttgaTTCCCGACATTGCTACCACTATGCAAAATTCCAAGTTTGCCGT
GGGTAAGACAAAGGTCTACTTCAGCTCGGGTTTGTTGCAGAGATTGGAGGACCGCCGTAACGTGATCCTCAAGGACCACGCCATTCTTATTCAGAAAACG
CTGCACGGCTACGTGCACCGCAACCGCTTCCTGCGTCAACGTGCTGCCGTGGTG