Description :
From Genome Similarity Track
Location :
contig_28:520187- 525460
Transcript NameFunction/comments
g5664.t1hypothetical protein

Sequence
5273 bases(100 bases per row)
CGAGCTGCTGCAGGGCAAGTTCGGCTTCCAGCGCAGCAGCGTGGCCAACCAGAAGGAGAATTTGGGCTGCTGGATCACCAACTACCAGATGCGCGTGCGC
GCCGAGGCCCCGCAAGGTGCCGCCGAGAGCAGCGACTTCGTGACGCGCACCGCGCTCGCCCGCGTGCACAAAAAGTTCTTCAAGAACTACGTGGCTTGGT
GTAAGTTCCTCCGCGCGCCACCGCGCTGCTGCGACCCAGAGAAGGACGCCACAGCCAAGACGGAGAAGGAGCTGGTGTTGTTCTTGCTGCTCTGGGGGAG
GCCGGCAATTTGCGCTTCATGCCCGAGTGCGTGTGCTTCCTGTACCATAATATGGCCAAGAAGTTGGACTTCCTGGACACGCTGCAGGACGTGGACGAGG
GTTTCTACCTCAACGAGATTGTGCGCCCCGTGTACGGCGTGATTGCCAAGATGCGTACAGCCACGGCACCCAAGGGCGAGCGTCCGTTCGACCACCAAGA
CACGACCAATTATGACGATATCAACGAGTTCTTTTGGACAGATAAATGCCTCGAAAGCGACGAGATGAACGTCGCGAAAATGCTGGAAGTGCACGACCCC
AAGACGTTCAAGGAGAAGCGCAGCGTGTTCAACCCCGTGCTGGCGTTCTTTAGGGTCTGGTACTTTTTGGTTGTGGTCTTTCACGTCCTCGTGGTGGTCA
CGTACGTGGCGTACATGGCCGAGGGCGACGACGACGGAGGCCTGGGCTTCTTTTTCCGCATCTTTGACAGCGGCCAGAACAAGATCCGCGCACACGCGTT
CTACACCATTTTCATCACCGTCACGGGCCTGCTGGCCATGAAGGTGGTGATGCAGATCTGGCTCTTCGGCCTGAGACTCTACAAGGACGTGTGGATGGCC
GTCGGCGTCTTCTGCAGGCTGTTCTGGCACACGCTCTTCTTCGCGCTGTTCATGGCGGTCAACTTTTCGCCGGACGGGTCGGCGGTGCTGGGATCTCTGA
GCAGCATTTTGCCAGGAGGAGGCACTGCCGGAACGTACTTGTCCATGGGGCTGATGTACATACTGATTTACTGCATTCCGGTGTTGCTGGCGGCCACGAT
CCGCGCGTTCTTCCCGAACGCGATTTGGGGAATTCGCATTGTGAACGCGCTGGATGGTACCAGTCGACAGTATGTGGGACGCGACACGGCGCAACCCTGG
AAGGACTACTCAAGGTACTCGATGTCGTGGTACATCATCTTCTTCTGCAAGTTCCTGTTCGCGCTGCAGTTCATGATCCGGCCGTTGATGGCGCCGTCGA
TTGAGATTTATGATATCACTGTCGATGACGATGGCGTCTTCCAATCGGGGCACAACATCATATTCATCATCGCGCTGTGGGCCCCCATCTTCGTCGTGTA
CATGTACGACTCGCAGATTTGGTTTATCCTGTATCAGTCCCTTGTTGGGCTCGTGATGGGAAAACGCATGCACCTTGGCCACTACGTGGGATTGGCCCAA
CTAAAGAAGGGAATGTCGGGGGCACCGAAGCTCTTTGATGAGAAGGTGGTGTCTCTTAAAACCAAGACGCCCAACCCGGAAGCAGTGACGCCTGTCCCTG
GCGGTGGTGATGCTGGAGAGCTCCGCCACCGCGACGTTGTGCGCCTTCGTTTCGCGATCATTTGGAACCAGGTGGTGATAATTTCCGCTTGAATGATCTG
CTCGACGATCGTGAGACTGTTATCTTGCAGTACCGTATCCTGGACAAGGGTGAGCGGATCCAGGAGCCGATCTTCCTGCTGGCTGGCAAGTTGTCAAAGG
CTGTCGATGTTGCAGCCAAGTCGCGTTCTAGCAAGTGGGACACCGCAACTTTAGTTAAAAACATCGCTACTGCAGACGCCCTGGAAGGCATGAAAATGGG
CTGGAGCTTGTTCGAGATATCTTCTATTTGCTGCTTGGTGAGGACGAGAAGGGTGCGCTAGAAGTGCTCGAGTATATCTACTCGTCGCCGGACGTCGTGA
GCCTGGTCGACATGACCTACTTGCCTCAGCTTGCGGATAACATGGTCGAGCTTCTTGCCGTGATCTTGGATATGCCGGAAGATATTTCGGCGATCGACAC
ACTGGAGTCTACACCCGAGGAACTGCGCATGGAACTCCACGTGCAAGTCGCGCAAGTGGTTGACCGCCTGCGCGCCATTGCGCTGACACTAGAGCTGATG
CTGAACGATGATACCGTCTCGCGCAAAGTGCACAACTGCCGCTTCTTGCAGACCACGGCCGACCTCGAGTTCCAGACCCAGCAATTGATATACCTCTACA
AGGCTGATGCTATGGCTGAAACTGGTCTGATCGCTGTTCACCCACGGGAGGGACCTGCTACGCCACCACAGCGCTTTAACCCGGAGGACTTCATTTCTAG
CTGCACGCGCTTATTCTTCTTGCTCCGCTTGGATGTTGCGAGTTCGCTTCCTCGTTGTGAGGATGCCAAGCGTCGCATGGGTTTCTTCCTCCACTCGCTG
GCGATGGAGATGCCCCGTGTGGACTCGATGGAAGCCATGCCATCATTCTCCGTGATGACTCCGTACTACTCTGAAACCGTATTGTTCACTTTGGACGAGC
TGAACGACCCTGTACACTCCAACCCGCTGTTCGCAGAGCTCGAGAAGAAGCAGAAGGCCAAGGGCTGGACGGAGCTGACGATCATGAAGTATCTGATCAC
GTTCCACGCTGAGGAGTGGAGTAACTTTCTGGAAAGAATGGGTGCTACCTCGCTGGATGAGGCTCTTGAAATCAATCCGACCGAAGTGCGGCTGTGGGCT
TCGATGCGAGGCCAGACGCTTGCCCGAACAGTTCACGGCATGATGCTGTACGAAGACGCCATCCGCCTTTTACGTTGGCTCGAGGTGTATTCTCTCCGTG
ATATGAGTACCAAGATAAGCTGGAGGAGATGAACCGCATTTCTGCACTGAAATTCTCCTACATCACGGGTTGCCAGATTTACTCCAAGCAGGTTGCGAAC
GGTGACCCTCGTGCGGCAGATATCGACTACTTGATGAAGTTCCCGAGCTGGCGCGTCAGCTTTGTGGACTCTATAACGGAAAAAGACGGCGACAAGGAAA
TCAACCGCTTTGACTGTGTGCTCGTTAAGGCCGAAGAGGGAGAAATTGTTGAAGTCTACCGTTACGAACTGCCTGGTAACCCGATTCTGGGCGAGGGTAA
GCCCGAAAACCAGAACGTGGCATTGCCATTTACGCGTGGTGAGTACTTGCAAACGATTTGATATGAACCAGGAGCACTACTTGGAGGAGTGCCTAAAGAT
GCCCAACTTCCTGGCGACTGCTACGAGCACCGGTGAGGAAGTGACTGTGATCGGTATGAAGGAGCACGTCTTCACGGGCCGTGCTTCATCGCTGGCGCGT
TTCATGACGCTCCAGGAATTGGTGTTCGTGACGCTGACCCAGCGTGTGCTGGCTAAGCCGCTTCGTTCGCGCATGCACTACGGCCACCCCGATGTGTTCG
AGAAGTCTTTCGTTGTACAAGCGGCGGTGTGTCCAAGGCTAGTAAGGGTATCAACTTGTCGGAAGATGTGTTCAGTGGCTACAACGTCACTCTTCGTGGC
GGCTTGGTGACTCATGTTGAGTTCATGCAGTGTGGCAAGGGTCGTGATGTGACGCTGAGTCAGATCAATGCGTTCGAAGCGAAGCTGTCCAATGGTTGTG
CTGAGAGTTGTCTGAGTCGTGAGGGTCACCGCCTGACCAACGCATTGGATTTCTCGCGCTTGAATTCGATGTTCTACGGTCACTTTGGTTTCTACATCTG
CAATGCCCTCACGGTGTTATGCGTGTACGTGTACGCGTACTGCAAGCTGTACGTTGCAACACACTCTGAGGTGGAGATCACGGCTATCATGAAAACGGGC
AGTCTCGACTCGCTTGCTAGTGTGATGACGACGCAGTATCTGCTCCAGTTCGGCATGCTGACCACGCTTCCTCTATTCGCGACTCTGTTTGTTGAGTTTG
GCTTCAAACAAGCCTCCCTGAAGGTGATTGAGTTGGTTTCGACTCTCGGCATTGTGTTTTACGTCTTCTTGACGGGCACGAAGGCTCACTTCTACGACGT
GGCACTTATTCGCGGTGGTTCGAAGTATCGAGGTACTGGCCGTGGTTTTCGATCACGCGTGACCCGATGGTGAACTTCTTCAAGGAGTATGGTGTTTCCC
ACTTCCGCAAGGCTGTCGAGCTAATCGGTGTGATGATTTTATTCGGAATCTACGGCTCGTTCAACATCGGATCTGATGCGCGTGACGAGTACTGCGCGAC
AGCGGACTTCGATTGCGATACCGACCCGGACTTGATCCCTGCCAACATCACGTCGCTTGCAGCTTTCAGCACCACGTCTCAGAGCTACGGAATTGCTCAT
TTGCTGTGTTGTTCCTGGGTGCGTGTTGGTTGATGGCACCCTTCGTTTTCAACACGGATGGCCTGGTTCTCCAAAAGTCCAGGGTGGATATCGCCAACTG
GTTCGCGTGGATGATGCGATCGCGCCACAAGGAAGACGGAACCGACGAACACACTAGCAAGGACGCAAGCAGTGCTGCTTTGCAGCCGAAGGATGGATGG
GACGATTGGTGGAAGTCGGACGTGGACTTAATGGTGCCTCTGGGTGGAATGGGCCGGCTTACGTATTGCATTCGTGAGCTGCGTCACCCGTTGGCTATGT
ACTACGTCTTCCTGACGGAGTTTACACTCCCGTGGCTTGCACTGCTGTTCGGCGCGATGGGTGCTACGTGGGTGCTGCTCTGGTTCGGAAACCGCGTGCA
CCACTGCGTCTCGAAGCACCGCAAGCTGAATTCGCTCGCGATCCAAGGAATCTTGTACATGATCTGCGTCATTGGAGGCATCCTTCTGGTGCCGCTGATT
ATTGGGGCCATGGGCGGTTGGTCTGTGCAGAAGTGCTTCACGTTCTCCATTTCGATGTTCTTGGGCTTCAACTCGGTCGTACAGTACGCCATGGCGTTCA
ACGGTGCTTTCGGAATGGAAGTGGCTATGTGGAGCCCCATCATGGCGCTCGGCTTCCTCATGGACATGATTGTCGGCCTGTTCCTGGTTATCCCGCTGTT
CCTGCTGTCGCTGCTGCCGTTCATGCGTATCCTCCAGACACGTGCCATGTACAACGGAGGCTTCTCGCGTGCACTGAGCTCTGGCTCGGAGGTGGCGGCT
TCGTTGGTCATCCTGCTTGGTTTGCTGGGTGGCTTCATCCACGGCTTCATGACGTCATTCCTGTTCACGCTCG