Description :
From Genome Similarity Track
Location :
contig_110:52012- 58915
Transcript NameFunction/comments
g11225.t1hypothetical protein

Sequence
6903 bases(100 bases per row)
CCTGTACAGATGTCCCTCTCAGTAAACGCAGGGGGCGATTTTAGAGGGATTATATATGGTGCAACAGACTGAAGAAAGTGCTATAGCGACCGCAAGTCGT
GCTAGGGCTGCTCGAAGGCTTTCAGGTCGCCCAGACACGTAATAGGCGAGTATGAAGAATGCACGATTTACACCATTTCATACTGTAGTACGATTTATAG
GTATCTTGTGCAAGACAAGCCCCAGCACCACATATGTGCCATTTTATTAAACTCGGCAACCTGCCACGTCACAGAACCGCATTCGTCGACAGTGGGACGT
TCCCAGTAACCCAACCACGCCCTTACCGTCAATCGGGATCAGCTCGGAGGATGATCTCCCGCCGCTCTTCGGGTCTGGGGACAGGATTCTCTTCCGGATT
ATCCTCAAAGCAGTGTCAACATTAACACCCAGTTGGCTCGAGAAGTATGCGAGTCCACGCCGCGTATAGGCCAAGCATATACCCATGACTGTCTGCGGAC
AGTCCGATTTCGACCCCATCGTCGCCTGTGACAACACCACGACGGCAACGCTGCGTTCGTCAACAACGGCAAGTTTGAGAGAATAAACAGGTATTAGATA
ATTTGTGAACGGCATCGCTTCCATTCCTTGGTGATCACAAGCGTCCCTCACTCCCGAGGACGGATCTCATCGCGGTGAATTATTCTGCACATAAGATTTT
GTCCGTTGTTTGGCTTTAAGCCATCAACGTTGCTGTTGAATCGACACTTTCGTCTATTACATGTATAGCAGATTTGCAGTCGCGTTGGGGGCATTTTTGC
GGTGCTGGAGTGCTTGTGTACGGTCAGTAAGTCTGAGTGTCCTTAGCGTGGTTTACAGTCTCTATCTATGGTGCTGTTTTTCAAATCCTTGGTGCTGACA
TGCCGCACTCTTTTTTCCAAGGGGTTGGCCTTGAATCAAGGATCTTGATGACGCCACCTTACTACTTGAAGTATTATCTAGTTTAGCACTTACCCGCCAT
CCAATACTATCCGAGCGGAGCCAGCAACTGAAATGTCGTGCCAGTAGCGAAGCTCTCCTTCTCGCAGCTACACCAGCTCGTTTGAGACACATGTGTGTCT
ACCTGTAGTGCAAACCAAACTGTTGATTGAGGCTGTAACACTGCAGCAAAGCAACCTCGTGCACTTTGAAGGTGGACACGTGGATACGCTGCCACAATTT
TAGACGCGACCATGATGCTATCGAAATTAGCCATCGTTAAGTCAATCTACGCATGGCAGCCACACAAGAAGATCATCGTCAAGTGCTGTTGCGGTAGATG
GGGGATCTGCGAAAGAGTTTCACAAAAGCGAACGGTATACTACCGGGAGTGGATACGAATCCAGTCTCAGAAGGGGTGTAGGTGTTTGAAGAGCAATGAA
CCGGAGGCTACTAGCAACAAACCCGGACGGCATTTACGGAGGCCAGCCCAATGTCCAGTTTTCCAGCAAGTCGAGAAATGCCTCGACCCGAGTTTACAGA
CATTTCTCTTGCAGGAGCGTTGCGCGTGCGAAACGGAGCTAAACCCTGAACTGTATCATTCCGTGAGATCGTCGCAACAGCTTTCTGTATACCTTAGTCA
AGCTAACTGTGGTTCCATCCCATCTCGATGATCGTAGTTACTCATCTGAGTTAGTATCCCGGATGCTCCTGGGAATGCCATCGCATTGTGCCAACGACGA
TGCAGCAACAATTTTCAAGATCCAGGTTGCGTAGGATAGCAGCGTGCTGAGCAGCCTCCTGCCTTCATTCCAGGGTTGGACGTTGGCAGTGAGTGTATCA
ACTCATTTAATTTTCACTTTCAAATCTGCTGCCCAACCCTCAAGTCCCCAATCCCCCCGACCATACGCATGTGTCTATCTCACATTTTCGTGGTGATCGC
GGCTACCTTCCTGCTTGCTAGCGCGACGCCCACGGACTCCAACCAGGCCAAGATCGTCCAAGCGACTTTGCCGGAAGGCCTGAGCCAGCGGCTTCTGAGG
ACCTACCCACGACCTATGAAGACGACGATTCCGAAGAAAGAGATTTCACTAAGGCAGAAAAAGCGTTGTTTAAAGCCATGAGGGGCAATGGCAAGACCGC
TGACGACTACGCTGAAGAGTGGGCATTGCCGCCGCCATGAGGGAAGTGGAGCGTACCGGAAGGGGGGTGCACAAGCTCCAGCTAACCCAGGCGTACGGGA
CTACGTCAAATACTACAACTACTTGAGGTCAAACAAAAACAAGTAGACAAAGTCTGCAGAGCAAGCAAGCAAGCAAGCCGCCGCAAGCGTATCACGTCAG
CGTCTGGCCTCGAACCAATTGCGGGTAGATTGTAACTGACGATTGATCCTTAAGAGTGTCTATCATCAGAAAACATGCATTTGGTGTGTGGCATTTGTAG
AGAGCCAGGGGAATATTGAGAGAGGGATGTGAGTAACAAGATTTGGAATACAGCACCATAATTTTAGGTGTCACCACTGTAATGCTAGACGCCAGCACCT
TAGCAATGGACAGGCTTCTTACAATGAGGCACTCTGCCTAAAATGTCTAGATGCTATTCGTTTGGGCTAGGGACCGATCGTCAAATCGGTACCTCAAACA
GCACACTGAAAGGCCAATTAGGCAGACGTATTAATGTTGGTTTTAGTATGCAATGTGTTAAGTACGATATAGTGCAGCCTAACTGACCCCTCGATTTCAC
TAATGCGAAACGACTGGCTAGATTTCGTCGGCGAGGGGAACTACGCAAAAGAACTGCCTCGCTTGAAGCTGGCCCCTCCAGTGCATAGTTGCTCTATTAG
CTACGGTGTCAGCTTTTTACCCCTTTGATAATACAGCAACCGCCTTCAACAGTGTGTGTGCTGGGAGGAATTGAAGCAAAGACGAGCACGGACGATGCCA
AGGTGCTGAACTCCTAGCCAGTATCTAAGACCCTCCAAGCATCAACTACTTCGGACCTTTCGGATCTCTCCACGGCCGATTTGAACGAGTTGTCGCTCTC
GAATTTCTGTTTGAACTGCACATACTGACTCCAGATCTTACTACACGCAGCTATGTCGAAGTACTCCTTCCACTTGCTACCGTGCGCCAAAGCAAGCTCC
CAGAAGCTTGACTCATTATTATCAATGATGGCTTTGGGTATGATGGGTACCGCTGCCGTAATCTCGCTGTTTACTTCGATCTGAATGCTTTGAGCAATCT
CCTTGTATTGCCGACAAAATGTTGTCACGATTTTGAAGGTGTACTCATGCATGACGCGGATGCAGTCGGTGTAGCCCCCGTACGCGATGGCGCCGTCCGT
ATTGCGATACTTAGAGTTGTATGCGTCCAGGCAGTGGCGGCAGTAGACATCCATACCGCTGATGCACTCTTTGCAGGGTTCGTTCTGGAGACAACGACGC
TGTCTCGCTGTAACGGGGTTACACGTACCCGTTAGTGTATCGTACACGAATAGTTTTTCACACAAATGGTGTGCACACCCAAGTTGGTGTGTGTACACGA
GACTTAGGTTGGCCTCCACCCGTCATGCATATTACTAGGCTCCACTATGGTAGATAGTGAGTGTTATACATTTACCCCACTGGCGGCCCTGCCGCGAATA
ACAACAATAAAAATCAGTTCACGTTTTGAAGTCTAGTGTCTATTAGCCTTATTTAAGGTATTAATAACTCTAGGAGTCTGTAGATCGCATATCTACAGAC
TGTACTTGGTTCTGGTATAGAACCTAGGTTTACAACCGAACTAAGACTCTGAGAGTCTACGTCTTCCTCTGACGCAAGCTACGGCAGCCCCGCTGCACTT
GGTAGCACTTGTAGTCAATCCTACACCTGAGTCTTACGACTGTCCCTCTGTGAGGATGGAGCAATTTGCCCACTTACCCCCGAACCAACAGGACGGGCTT
AAAAAGCTGATGTCCTTGTTGGGCCCGGAAGGTGTGGCTCATCTTGCTTCGCAAGGCCCCGACGCGATTAATGCGCGTCTGGAGGCGTTCTCGAGTTATG
AGAATGCTCTGTTGGAACATCTACAACAGAAGATGACGGCTGTGACAGCGTCTACGACGCCCAAGCCGGCATCGGATGGAGCTCCACGAGCTAAGCCGCT
CATGGTGAGCGTGAAGACCTTTGAGGGCAAGGAAGGAGAGAATCTCCTGCTCTGGATTAGAGAGGTCGAGATGGCCATGGCGTCCGCCATACTCCAGACG
GAGCAACAGCGCGTGGCGCTGGCCGTGTCCAAGCTGGGTGGCCGGGCCCGGGAGTGGGCCCTAACGTGTGGCACGTCGGTGGACAGCGCGTTCCCATCCT
GGGAGCAGCTGAAGCTTCAGCTGTCGCGAGTGTTCTCGCCGCCTAACCAGGCCTATCGCGTGCGATCACGCTTCCTGGCTACCCGCCAAGGAAAGAAGGA
GTTGGTGGACTTCGTCCAAGAGTTACGAACTCTTATTGCCGGTATGGCTGCGGACCCTCTTCCGGAGGCGGTCACGGTGACCATCTTCATGGAAGGCCTC
CGCACTGGCGTGGCCAGAACGGAAGTATTCCGAGTTCACCCCACCTCTTTTGAAGAGGCAGTGAGCGTGGCGTTGAACGCCGAGTTCAACTTTAAGTCGG
CCCGAGCCGGGTGGGGAACGTCGCAGACGAACTCATCCGGAGCCGCCGGCTCCTCGGGTGGCCCGAGCCGATGGATCTCAGCCATGCTGAAGACGAAGAA
GCTGAGCTTCTTGCTGCCGAGCAGCGCATCGGCATCCGCCGGTGCTTCGTGTGTACCCAGCACCTGCGACCAGGTGCCCGCTGCGTAAGCAGCGCCAGGC
TCCGGCGAGCCGAAGCCCTGCTTCTTACCAGAAACCTGGTTCGTGGCGGGGAAACGTCAACGCTCAGTAGGCGCGGGGCGGCCTACTGGGGAAGAACTAA
GTTCTGTTGAGCCTCAGCAAGGAGGTCAGCAGGGCTTAGCCCCGAAGAGCACCGTGCTCTTTAACACGGAACGTGTATGCAAGCCGGGCTTGCTGGTCGT
TGAAGCGACCGTGAAGGGCTTTGATAAGCCGTGGACGATATTGATCGATTCGGGAGCGTCGGGCAATTATGCTCGACGCTCCACGATGGAAGGAAGTCGG
CAGTATGCCGAGGCGCTGGTAGCGCGTACGAGTGATATTATCACTGTCCGTCTCGCGACGGGAACCCGCGTTACGGTGCCCAAGGTTCCTGTGAACCTTG
GCGTGAAGTTTCTGGACTTCGATAGCGTTGAACGCTGTCTGGTCCTTGACCTGGATTCGAGATATGATCTCATCCTGGGCATGGCATGGCTGGAACGCCA
TGAGCCATGGATTGATTGGAGGTCTAAGACCTTAGGCGCTACGCGGTTGCCTCCTGGTGAAGCTTTGGCGAGTCATGAACCCACCTCTGCTAGGAAGCAA
AAGCGCTATTGGCGCGAGCACTGGACCGAGACGGTCAACGTGCTGGACATCGGCGTGTCGGAGTTGATTGACACTCATGATGTCGTAGACAAGAGTCCCG
AAGGGGCTGTACGTGGAGCGGCACGTAATCCGCTGAGCGGGACTCGTTGTGATAACGAGCCATCGCTGCAGGCCGCTGATGGCATGGTCGGCAGAAAGCC
GAGGCATCGTGGGCATAGCCCTGATGATGCGCGTGGAGCGGCACGTTATCCGCTGAGCGGTGACGCGATGGCGAAGAATCGCTGCGTGCCAACGATGGCG
CGGTCGGCCACGAGCCGAGGCATCCTGGGCCCAGCCCTAACGATGCGTGTGGAGTGGCACATAACCCACTGGGTGGGGACTGCGAGCTATGCAGCTCCTC
GCCGGATGTCGAGTTTGACGTCGACGCTCCGATGAAGCAACAAGAGGTGGAAACACCTGAGGACACCTTTGGTGTGAATATGCAGGCCTCCCCGAGGCGT
ATGGTCTCCGCGAGGAGACGGCAGCGACGCCGTGTGGCAGCTGCGAGACGCAAAGCGTCTGTTATGACACAGCAAGTGTCGGGGTGGTGGATAGCGAACA
GCTATATACACTCGTTAATGGAGTGACCGGCGAGGTCGCTGGCGACGTCAGCCTTGAGGCTGTTCCCGCCGCAGATGCTCTGCTAGAGCTGGACGAAATG
TCAATTGCCGAGTTCGGCGAGGCCTTAAAGGCGGGCGAATTAGCCGAGGTCGCTATTATACGACCTGAAGATGAGTTAAACTCGTCGTCCCTTATGGACG
AAACAGTCCTGGAGGACACGAAGCAGGCGCTTAGTGCGCGTAGTGGATCGGCGATCCTGAAGGATCCTTCAGATCCGTACTATCCCTTGGTTAAGGAATA
CCAAGATGTCGTTTCCAACGATCCGCCTTCTGGCCTACCTCCAGATCGAGGCGTGCGTCATGAGATTGACCTGGTCCCTGGAACCAAATACTGCGTAACA
AGGCAGTGGCCCTTGCCAAGGGAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAACACGAGGCGGGCATGGTGCGCGAGAGCAAGTCTCCGCACT
CGACGCCGACATTCTGTGTCAGAAAGTCAAACGGCAAGTGGCGCATTGTCCACGCTTTCAATAAGCTCAATGCCGCCACCATTCCGGCGCAGACGCCTAT
TCCTAGGAAGGATGTTCTCCAGAACAACATGGTTGGATGCACAGCATACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGTTGCTCATGCGTGCGAGC
GACATTCCGCTGACAGCGGTCAGCACCCCGAGCGGGATGCTCTGGGAGTGGTTGGTGATGCCCCAGGGGCTGTCGAACGCGCCCGCGACGTTCAATCGTC
TAGTGACGCAGCTCTTCCGGCCCCATCGGGCGTATGCACAGACATACTTCGACGACATTTTCGTCCACAGTCGTGCCGAGCACGGGAAGTCAGATGTGGA
CAA