Description :
From Genome Similarity Track
Location :
Scaffold_203:52007- 53114
Sequence
1107 bases(100 bases per row)
ACGAGGAACCTACCTCTTAACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGT
CGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGGCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCA
GACCCCCCTTGACCCAGCTTTTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGC
GGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCTGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTG
GGAGTGTGCCTCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCC
ACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTAC
CGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGA
ACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGAGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCG
GATCCTCCAGGAGCAACGGTGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTC
CTGATTGACTGCCTGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGA
ATACATACCGTACCCGCGTTCATCGTGAGCGCTAGAAGCTGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACA
CGAAGAT