Description :
From Genome Similarity Track
Location :
Scaffold_1287:520- 7648
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1287-snap-gene-0.2Fat-free family protein
Pytir_DAOMBR486maker-pir_contig_1287-fgenesh-gene-0.13'5'-cyclic nucleotide phosphodiesterase

Sequence
7128 bases(100 bases per row)
GCGTCAAAGTGCAGCAAGAGGGAAGAGCGAGGAGAATGGCGTCGACGGCACAGGAGGAGCAGGGCATGTCGCGCATGCAGGAGCTGCTGAGCAGCTACTA
CGGCATGCAAGACCGTGAAAGCGAGGAGGAGAGTCTGCGCAACATCAACTCCAAGGGCTTCGACTCCAGCACCTACGTCAAGGTACAGAACACTCTTGTG
GATCTATCTATCTATCTATCTATCTATCTGTGTGGGTAGACTCTCCCTGTTTACTGCGCACGCCAATGCAAGAGCTTACCTCCCATGTGTGTGTGTACGC
ACGCATGGCGCGTGTGCGGTAGGAAATGCTGCAAGCGCGCGGCCTGAACGACCTGCTGCAGCGCGACGACCAGCTCATCCACGAGATCAAGGAGCTGGAT
ACCAACATGCAGATGCTCGTCTATGAAAACTACAACAAGTTCATCAGTGCCACCGACACGATCCGTAAGATGAAGGTAACTTACAAGTGTCTACTGCTAC
TGTTAGTACAGATATATCCTGCGTGCATGGGTATATAATAGCGCTGTTCGCTTAATGTAACGTTGATGTATTCAATCTCCTTCACTATAGAACAACGTGG
CGAGCATGGAGGAGGAAGTGGGCAAGGTCGTAAAGAGCATGGACGTGATCACGGAGAAGAGCGAGAGCATCAACGTGGCGCTCGCGCCGCATCGTTCGAA
AGTGGAGAAGCTCATTGGCGTACGTCGCCTGCTCAAGCGCCTCGAGTTCATCTTTGAGCTGCCGCAGCGTCTCAACACGTGAGCTCTTTATCGTTTGCGA
ATCTTCAATTGGTAAGTTACGCACCATGGGCCAAACTAATTATCTGTGCTATGCTTGGTTGTATGCATTAGCGCGCTCAAGCAAGAAGATTACGCGAATG
CGACCAAGTACTACCTGCTCGCGCGCCGCATCCTCGGTCGCTACGAGCACATCGCTTCGTTCAAGGTATGCACCACACATTGATGCTATGCCATTCGTAC
AAAATTCACTATTTGATTAATTACTGCCTTTTAACGTGGGATTGTGTCTTGCATATGCGGACAAAAAGACGATTCAAGTTGAAGCCGAAAAGATCGTGCA
GCAGCTGCAGCAGATGCTCGCCAAGAGACTCAGCAACGTCAGTCTCTCGTCTGAAGAAGTGCGTCCTAATGCATTGAGCCACTCGCACATCCCCGGCATC
TCGTGCTGTTGATGCTAGCGCTCTCTCGTTCACTATCTTTCTTGTGCTGTGCTGCTAGATATGTGAGACCGTGACGCTGCTCATCCAGTTGGAGGCGTGC
AGCGAGGACATGCGGCAGCAGTTCCTCGATTGGCACCAGACGCACTTTGAAAAGCGGCTCGCGGCATATACGGTACGGATTGGCTCCCTAGTTTGTATCT
TCTACATGCTTTGTAACACCGGATTGCTTGTGTGTGGATTATGTTCTTTAGACCGTCAACAAGGACGAGTCCGTGCTTGTGTTTCTGCAGCGCCTGAACG
ACGACGTGCTGGTGAAAATGGGCAACGTGTTTCGCGTCTACAAGACCAACTTCCTGCCCGACCTAGTCGCGAAAGAGAAACGCGGCGGGTTGCGCGCGTC
GTCTGCTTTACAGGACGACGCGCTCATCACGTTTGCGTGCGAGCTCTTTGCTCTCTACTTGCGAGTATGCGCGAACCAATTTCGTCGCCCGCACCAAGAA
TTTGTGAGTGGTACTTGCGATATTTACGGACTTTTCCTAACTACTATCACTGACTCCCATGCTAACGGCTTATCGCAGGGCAACGAAGATGAGATCTACG
CGATTCAGAATGCTGGGGCGGACGGTGCTGATTCCCTCAACCTGCCTCCTGGAGGTGGCGGCGCGTCAGACGAAGAGTACATGGTACTCATGTGCGTGCT
CAAGTACTTTGTGTCGCACGTGAAGGAGATTGACGCGATCATCCCGCCCTGTCGCTTGATCGGCGGCGCCGTTGAGATTGTGGAGACCTGCGTACGTTTC
CAGATTGAGCGCGTGTTCCGCAAGCTGCGCACGGGAACGACTGAGCTGCTCACGAACTCGCACTACCAGGTGAACCATCTCCGCCAGAACAGCCGCAACC
AGAGTCAAGGCGGCGGGTTCGACAGTAGCCAGAATGTCCAGCCAGCTGCGCAAGAAGCCGCACGAACGTTCACGGACATGATGCAGCAAGTATTGCGCCA
AATGGAGCCGCTGGCGCAAACGGGAGCGAGCATTTTGCGCGAGATGAGTCGCCTCTTCTCGGACTTGGTGCAGGTAACTAAACCGTTCTGTCTGTGATTA
TGTCGCTTCCATCTTCTAACAGATCTGTACTTGTCATGTTTGCGACTCTAGACTCAATTTTACCACTTCCTGAAGTGGTTCAACGCGTCGCTGCTGACCT
ACACGGAGGCAAAGCGCGCGTTCACCCCTCTTTCGAGCAGCGAGAGCAACAGCCAGCAGAGCCAGGACCAGGAGCTGCTCGGTGACGAAGACGTCGCGCT
GCCGTGGCTCGAGCCCACACCGCCGTTTGTCTTGTTTCTTGCGTTCATGTGCCAAGAGCTCGCGTCGGAAGGGATCGGAGAGTGCATTCAGTTGCTGATC
GAATGTTTGCCAGCGAACGCTGTTGTCCAGAGCCCAACGTCAACAGTGACGACGAGCCATAACCAAAATGGTGGAGGATTGGGAAAGCAGCTTGACGTCG
CGCACATGGTGCAAGTGACGCGCGAGACGTACGTGGAACTGCTCCAGCACGTGGTCAAGCACTACGGGAACCAATTGTGTGCGATCATCAAGAAAGGCAT
GGAGGCGACCTCGTGGGAAGACATGGACGACGAGCCGCGCAATGTCCAGGAGATGGTCGCAGCGGTAATCGACGCGACGTTCCGTCACGGCAAAGAGATC
GCGCTGGCGCTTGGCGACGAGCAGAGCGGTTTCCTCAGCGGCTTCAACTCTCGCACGGGCAGCCGTGACTTCCGTCGACGCACCAGCGGGCTAAAGTCGC
GAGGTGGCGGTGCTGGCGGCTCGGGCATGCAGCTGGACATTGAGCGCATCTTCGCCAAGCGCATCCAGATCTTCCAGCCCGTGACCGACCTCAACACGGA
GTGGTTTGCGCAAGGGATCCTAAAAATGGCAATCAAGGCGTTTGGTGAGCTCGTGCGCATGCAGGAGCTGAGCAAGTTTGGGCTGCAACAGATCCAGGTG
AATGCGGAGTTCCTGCGAAGCACGACGGTGCACTTGGTCACGGAGAGCCAGGAGATCGAGAGTCTGCTCTCAGACTTGCTCTCGAACGCGCGCGAGCGGT
CGCTGGAGGACGTGCTGATGGAGCAGAGCAACGTGGTGGCGATCGTGAGCACCAAGAGCACGCAGGTGCTGTCCCGGAAAGTTTAAGAGAACGAAATGGT
TCTTCAATCAATCGTCATCCAAGATCGCCAAAACTGTCTATAAGTATCTTTCCATTTGCAAGTACACATATCTGCTTCATCACACTTTGGCTTTGACTGT
TTTCTACGCGCTGAACGATCCTCTCTATCGATCGATGCATCGATGGTCTGTCTGTCACTCGTCGGCAGGCTTTTTTGCCACCAGCAGTCGCGAGCTCTCG
CCGCGCACGTACATCACGGGCGGCTGCTCCTGCTGCTCGCCGAGGATCTTGTCGAGATCCGACTTGTAGTACTCGGAGTTGGCCTCGAGCGAGTCCGCGT
ACACGCGCAGCTGCTTGCAGAGCGTGGCGAGCGGGAGCCAGATGGGGCGCAGCACGTAGTTGATGAAGTTCATCTGCACCGTGATGCGCGTCTTCATCTG
GTGCAGGTTCGTCATGTACGAGTCCACGGGGACTTTCATCTCAGCCTCGCTCTTGGCCTGGTTCTGGAACTCGGTGAGCACGCGCATCCCCCAGCGCACG
GCCTGCTCGTACGGGAGCGCCTGGCCCGAGAGGTCCGCTGCGTGCAGGATGACCGCCATGAGCACGTACTTCTTCTCGCCTAGGTGGCGCTTGGAGAGCC
CCTCGGCGGCCTTGCACTTGTCAAAGTGCTTGGACATGTCGGTCGCCAGGATGCAGTGGATGATCAGCCGGCGCACACGCAGGAAGCTCTCGCGCGGCAG
GTTCTCGAGGATGTTGGCCGACTGGTGGCTCAGGATGATGAACGTCACGCGGCAATGGTGACGCTCGAGCACGGCGTCGTCGTTGTGCGTGAGCGCCATT
TGGCTCAGCGACTTGACCTCAAAGTCGTTGTTGTTCCCAGGGTGATCGATGTCTATGCAAAGGCACAGATGGGGTAAGAGTTAGCTCGATGAGATGAAGT
GCCGACACATATATCAGTATCCTATCTACCATGGCAAAGCGCGGCGACGAGCATCGTGAAGATGTCGACCGTGGAGAAGTACGAGCTACACTCGCGGCGG
ATCATGATGTACGTCGCGTGCATGACCTGGAACGCGTGCTGGAAGTTGTGGAACGGGTTCGCGCGGTAGTGGCTCGCCACGTGCGCCAGGAACGTCGCAA
ACTTGTCGCTGCGGATACGGAAGGTCTCGAGGAAGCCGAACACGCGGAAGATCGCGGTCACGGACATGGAGATATCGGCGTTCGGCAGGTCCAGGCAGTT
AAAGTCCCAGCAGTCGAGGTCTCCGATGCCGATGATGTTGCCGTTCTCGCGCAGCATGATGAGCTCGTCGCTTTGGTGCACGGCTTTTACCCATGAGTCC
GCGGCAGCACCAGTACCTGTGCCTAACGTCGACGGCGCTGTTGGCGTCGAGTCGAGCCCGTCGATTTCGTTCAGCTGGCAGTACTTGTGCACAATGGACG
AGATGATCTCGGGCTCCGTGACCTCGGGTGACTCGGGCGTGATGATCGATCCCGTCGCCTTGTTGACGAGGTGCTCACTCGGCAATTCGCTGCGAGGGTC
CTTCAATCCGCAGTCCGAGACGACCTTGTAGTACGAGATGTCGAGCGAGAGTCTCCCGAGCGCAAACTGGATCTCGCGGCAGTACCGTGACATGCTTGTC
GTGTCCGTGTTGGTGAATGGCACCACGCGCGCTCCCTCTTTCTTGTTGATGCACATCGCGACGGCGACGATCTTGGGGTTGACCGGCGCGTGGTCTTCGA
ACACGGGCATGCACAGCACACTCGTGGTGCGGTAGCCCGTCTTCGTGTCGAGACTTGGGTCAAAAAGCTCGTGCGTGTACGCGTCGCGCGTGCAAACGGT
CTCGCCCGTGGTCGCCACGAGCCCCGAGATGCCCTTGTTCATCGGCATGCGCACGTTCTGCCCGCCGACCTGCGTGATCCAGAGCTCCTTCTTGAGTTGG
TCCACGAGCAGGAAGCCGAAGCGGTCGCAGCTCATGAGCTTCTTGCCCTCGTCGATGATGATGCTTACGAACTCAGCGATCGACGCCGAGTTGCTCACAA
AGTCGGTCAGTTTAAGGCGCGCCTCGGTGATCCGCTGCGACGTGATCACTTCGCGCAGCAAGTTAGACTTGTGCAGCGAGATACCCGCTGCGTCCGCCGC
GTAGTTGAGATAGAGCGCGTCTTCGGACGTGAACTCGCTCGTGTCGGCCTTGTTGGACGCGCAGACGATCGCCAGGATGTTCGAATCCGCATCCTTCACT
GGCGCGCAGAGTACCTGCTTGGTCACGAACGAGTTCTTCTCGTCAAAGCTCGGGTCGAACTCCGGGTGCTCCTGCGCCGAGTTCGTGAGCACGAGCTGGC
CCGTGCGCATCACGAAGCCTGCGATGCCGTTGTGGTCCGTGTGGTACTCGTCCTTTGACGCGCCCTCGACACCGCTCGCGATAAAGAACTCGTTCGTGCC
CTCATCGCGGACGTACAGCGCGATCTTCTCGGCGTTGAGCAGCTCGTACGAGATTGAGATGATCTGGTCGAGCACGGACGACGTCTTGATCTCGGCCGAG
ATGTTGCGGTTGAGCTTCAAAAGACACTCGATGCGGCTCTGCGCCGTCTGGTGGGACTTGGCAAGTGACATATTCCAGATCGCCATGCCGGTGATCACGC
AGATGTAGTAGAAGCTCTCTTTCTCCTGCGGCGAGAAGATGGTCTTGGGTTGCACGAGCAGAGCGACGCCGCTTACCGCCTGGGTCTGTTGCTGTTGGGA
GCTACTGCTACTGGTCTTGCTGTCTCCTGTTGTCGCATTCTGTGAGAGCAGCATGCCCTGCAGTCGCTTCTTCGTGATCACTTGGAAGACGCCGACCAGG
ATGCCGTGCACGTTGAAGATCGGCACGCAGAGCAGCGCCTGCGGCTCAAAGTCGAGCATGTCGAGCTGGTCTTCGTAGAGATCGAAGATATCAGACTCGC
CGACTTCGTCCACTTCGAGAGGCTTCCCCGTCTAGCCAGCAGACGAGAACATGGTCAGCCTCGTGCAGCGAGCCTCAATATCGCATTCGATAGATCAAAA
AGCAGTGAAGACGCTCTATACGTACCAGTACAATGCGGCCGAACGTCGTGGTGCTATCGACCAGGATCGTGCCTTCTTCCATGTAGTCTCGTCCAGGGAT
CGCCACGGGCGGGTTCGAGAACAGCTCAATCGCGTCTTTCTTCTCGTTTAGGATGCCCAACGTGTACTTCTCGGCGCCGATCACGTTGTGCGCCGCACGC
AGCGCAGTGCTCACGACGTCGAGGTACGCGGATTTCTGCGAGATGTCATGCGTCGCATCCATCAACACTCGCAGCTACACACGTAGACAAAGAGCAACGT
CACTGTAAGTCGTTTGAGCATAGCGATGCGGACTGGTATTTCTCACTATTAGAGGATCACAAAATAGGGAACGTACGTACGCTCTCTTCGCGCACCAGGA
GTTGGTTGAGCTCCTCGGCCTGCTCGCCCAGCAAATCGCGGATGCTCGACGCCGAGAGCAGCGACGTCTTGGAGCGGCTGCGCGAGTAAAAACCGCGCGG
AATGCTGCTGCTGGTCACGCGTGGGTGATGTAGGTCCGGGCGGAACGATGCGCAGCGCTCGAGCTGGTCCTGGCGCTTGTGCAGATTCGTTTCGAGCGCG
AGCGCCTCGGCGTCCAGCTGTGTGAGCTCGGCTTCGAGCGCTTTTTTCTCGACGATCGCGGCTTTCGCGCCACCGATCGCCACATTCAGCGCGTCGAGCG
GCACGCGCACCATCTGCTTCCCACCCTC