Description :
From Genome Similarity Track
Location :
Scaffold_79:52- 5968
Transcript NameFunction/comments
g8540.t1OWZ11528.1 Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase [Phytophthora megakarya
g8541.t1hypothetical protein
g8542.t1hypothetical protein
g8543.t1ETI34466.1 hypothetical protein F443_19035 [Phytophthora parasitica P1569

Sequence
5916 bases(100 bases per row)
AAGCACAACTGGTGGAGCTACATGAACAAGGCGTTCGAGCTCAGTCGCGTGTTCACGTACAAGTGGACGGTCAACTGGAGGTTCATCGACGAAGAGACGT
TCGTGTCTGGCGGATTCGCGATTTTGCTGCTGTTGGGGCACCTCTTCTTTATGGTGCTCTTCCTGGACAAGCACTTCAACATCATTGGAACGTTCCGCGC
CGTCCTCATGAAGCCGTTTGCGATTTATGAGCCGTTCCCGATCCAGAGTGAGATCGTTGTGACGTCGCTGTTTGTGATCAATTTTGCCGGAATTGTGTTC
TCGCGTACGCTGCACTACCAGTTTTACTCGTGGTACTACCCGACGCTGCCATACTTGCTCTGGTGCTCAGACCTGCCTCTGCTGTTGAAGATGGCGGCGC
TGCTGAACAACGAGTACGCCTTCAACACGTTCCCGTCGACCACGATGAGCTCGCTCATGCTGCAGCTAACGAACCTTTTCCTGCTCATGACGCTGTACCT
GAACCAAAAGTCGAATTCGTTCGTGCCGTACCTGGACGCCGAGGCCCGCACGAACCTCATCGCTTTCGTGAACGAGGAGTGTTTCGACGGTGCGCGTCAG
CTCGCGCTGTACTACGGCAGTGTGACGGAGGAGCTGGCCAATGGTGCAACGGTGTCGTCCATCGACGAGCACGAAGTTGTGCTGTCGCTGCCCAAGCTGA
AGCTGACGCTCGCCGTTGGTTTCGGCAGCAGCGGCCCCGTGACTGGCGAGGGCTACGGTCGCCAGGTGCTCAAGGGAATGCTGAGTGAAGCGTCAGAGGG
CATCAAGGCTGGCGATACCATGGGCAAACTCATTAACCGCGAGTTCATGAAGGACAAGGAGCTCAAGAATCTCGTCGGCTCGCTAGACGACCAGGGTAGC
AGTACCTCGCTACGTCAGCGTACGACCACCAAGACGACGAATGTCTAGGGGAACTAAATACCCTTGTGAATTCGCTTTCCATGTGGTGTACATAAAAGCT
CGTGCAAATTTATTCTACCTTGAGCCAGCCATTCTGCTGGTCGTGTCATGACGGTGGCGTTGGCGTTCGAGAGCGACGATGGCTCGCGGGCCATCGAGAT
GCAGGTGCAGGTGCAAGAAACTGACGGAGTACGCACAGAAGATTGCGACCTGAACAAGTTCTTCGACATTGCGCGCACCGTGGAGCAGATCCGCCGTGGT
GGGTACAGGAAAATCGCGCTGCAGTTCCCGGACTCGCTGCTGCCGGACGCGTCGCAGGTGCAGCAGGAGCTCAAGGACGGGCTTTCCGGCCAATGGGAGC
GCGTGTTCGTGCTCGGAGATACGTCGTACGGCAGTTGCTGCGTGGACGAAGTGGCGGCGCAGCATCTCGTGGCCGACTGCATCGTACACTACGGTCGCAC
GTGTCTCAGGTACGAGCTGCAGGCTGTAAACGAGTGGAGGGATATTACTGGAGACTGATGACGAGGTGGTGTGTGGTGCAGTGCGACGACCAAAATTCCG
GTGATTTACGCGTTCGGCAACGCAACGATTGACGTCGACGATTGTGTGCAGCAGTTGAGTGAAGCCGTCGCTGGAGTGGACGCGACGAAGACGGTCGTGC
TGCTGTATGAGCCTCGCTACCATCATGCTAGTGGTGCTGTGTTTGCAGCGCTGGAGGAGAAGTTTAGTGACCGGAACATGGCATTTGGCACGATGAAGAC
GTTCTTCGACCCGACGGAAGAGGTGAAAGATGTACCGTGTGATGAGGCTCTTTCAACCTCGGTGCTTCACATTGGCGGGCAGGAAATTGTGGTGAACTCA
GGGAATGCAGAAATTACCCCGGAGACGTTTGCACTTCTGTACATCGGCGCGGAATCGGCGCACCTCACCAGCATCTTGATGCGCTACAGCACCGTAGACT
GCTTCTCGTACAACCCTGAGATGATGTCCACGCGCAAGGAGGGTGCAACCGTCAATCGTGCGCTCATGAGACGGTAAGGTGTTTTTGCTGACATCGACCT
TCTACAAGGGCGTAATGGTTTTGTTTGCATGTCATAGCTTCTACCTCGTCCAACAAGCGAAGGAGGCACAGATTTTTGGCATTTTGATGGGCACGCTAGG
TGTCAACCGATATCTTGACGTGGTACATGGCCTTCAAAAGCTGATCAAGAAGTAAGTGAGCTAGTTTTGCTTTGGTCGATAAAGATTTCGGGCGCTAAAG
CATTACTTGTGTGATACAGGAGTGGACGCAAGTCGTACCTGTTCGTGGTGGGCAAGGTCAATGTACCCAAACTTGCAAACTACGCTGAGATCGACGCTTT
CGTACTTGTGGCATGCCAGCAAAACACACTCATGGACAGCAAGGAGTTCTACAAGCCTATCGTTACTCCGTATGAGCTGCAGCTGGCACTCTCACCCACT
GAAGAATGGGATGGCCAATATAAGACCGATTTCCGGGAGGTGATCCCAGCTCTAGAACAGACTGCGCAAATTGTGGAACAAGCAGACGGCGACGATGAAG
ATGCTGACAAGCCTTTCTTCTCGCTGGTGTCTGGAACGTACAAGACCTCGTCGCGCACAACGGCCAGTGATCGCGAAGCTACAACATACGCCCTCGCCGC
CTCTGAAGAAATCGATGCGTCCACTGCTTTGCAGGTTAAAAACGAGCGTACGGAGCTCACGGCGTATCACAGTGAAGCTGCTGATTACCTGGCTGCTAGA
GAGTACCAGGGCTTGGACCCCCGTATCGGAAAGACACCCGCACACGCTGCTGTCGAGGGCAGTACCGGCATCGCGCGAGGCTACACCCACGAGACCGAAT
AGAGAGATAATGGTAAATGGAAATCAAACGACGACGTTTGCAGAACTTGAAAGCTGAAGTGCTTCCGAGAATCACCTGGTACACTGCAACAACTGGTAAG
CTTAGGAATTGCCAGTTGTCGCCATCGCTTCTTCTTCTCGTCGTCCTTCTAGAGTGGATTCCTAGTACGCCAAGTACCTTAACCTACTTTGTTGTCTGTC
TCGTTGTGAGAGCCTATGCAATAATGGATGGTTCATTTGCTCAAATGAAGGCAAGTTGAAGTGAACTCCAAGTTGCCATTTTCTAAATCGCACTTAGTCC
GACTCGCACTTCCCAACCAGCGCAGCCAACGCACCATGAGCGACGGCATCACCGCGTCTCGCGCGGAAGTCATGGAGAGTACGCGCGCTCTCCTCCGTCC
TGCAGTGCACCTCTATCACCTATAACCCTTTACGCTATCCTCCTTTCACAGCCGTGTACGAGCTCTCCCGGCTGCTCAACACGGGGCTGGACCGCGACAC
GTTGGCGATCCTCATGGCGCTTATCCAGAAGGGCGTCAACCCCGAGGCGCTAGCTGCAGTCGTCAAGGACCTGCGCAAAGACGCAGCAGAAGAGCAGCAG
GCGGAGACGCCGCGAGTCACCGGCGGCAAGCAGCCCCTGTCGACCCAGGAACTCCAGGTCAGTCAGGTGTGTTGAAAGAAGCGCCGTCTTCTTCACTCAA
TCGACCTCTGGACTGACTGCTGTGTGCGTGTCTGCCTCTTAGAAGAAGCGCCGCTCAGACTACTAGCCAGCTAATTTTCGTGGTGTAGTTTCCTTTTTTC
TATTGGCGTTTGTTGCTATTTTGCTATTGAGTGGTCGTACCGAACTGCTCGCCACGTTGTCTCTGCACTTCTAGCTGCTACAAGCTGATAATCGACACTC
GCTCAACCCTCTTCCTGATGGTTGTAGCATCCTGCACCCGTCTTATGTATAGTCGGCAAAATCTCTTACTATTTGCAATGAGTTTCGCCGTCGGCTAACC
CCGCGTGATGCGGTGCATTTCGACGATGAGAATGCGGCCTTCCAAGAAGCCGGCGATCGCGAAGAAGAAGAAAGTCATCACAGGGCGCAATACCGGATTC
TGGAACAAATCAGTGCGCCCCACTATGTAGAGGAACTGGAGCTGCGCCAATACCAGCAGCGGAAGCTTCTTGATGCACCACCAGACACCGCCCAACAACA
GCTCTGAGGTAGCAGGGACCTCGTCCTTCTTCCACTGCGCCGTGCGCAGCGTGTGTGCGATGGCAAAAATGAGCAGTAGCGTGGTCAACATCAGATCGTG
CGTGATAACCCAGAGCTTGCCGGCGTAGCTAGGATGCATCGTGACCGGGATCACCTCGACGCTACACCAGATGAGCATGACAACGATGGAGACACTGGAC
ACCAGAGGCATCGACGCCACAGCGTAAAGCACACTGCATGAGAACTGGCAAGCACGGCGAACCACCCTGGAGTTAAACACATCGATGGACAGCGGCTGCG
CGTTGCCAGGGGTTGGAAGTCCCCAACTTGACAGGCGACGCGGGCGTCCATTTGGCTCCGTAAACAGCTTCAAGCATAGCGAGACGTAGGCAAACCAGAT
GAAGGCGAAAATCACCAGGAACGATACCACCTTGCCCATGAAGTAGCTAAAGTGGTCTTCTCCCAGGCGGTCGCGCACGTCCTGCCAATACCAGAACACT
TGGAAGTAAGTGTACGGCAGCCAGAACCACGGCTTCAATGTGGCGCCGCTGTACTTGTAACTCAGCAGTGGGCCGGGAATTTCTCCCGTGGCCAGGTTCT
TGTCCTTGCATTTGTACAGGTCCCAGTTCATGCGCTCGTAGAAGACCATGTGGTTGATGCTGTAGTAAAACGGCAGACGGTGGACGACAGAGCTTTCCAC
CGGTTCCTCTGCATCGTCGCCATCGTCAGCGCCGTCGCTCTCTTCTCCGTTGTCATCTCCATCCCACCCAAGGAAGAAGAGCGGGCTCTCTTCAAAAGCC
TCAAAAAGTCCGGGCATGAAGCCCTGAATGATGCCGATGTAGTTGTACTCGCGCCCAGTGATCATGAAGCCATCGATAGCGTCCGAGTACAAGTTGCGCG
CCGCAATACTCTCCGGGGAGATGATCAGCAGTCCATTTGAGTAAACGACAGACTGGCCATTGTCCACGGCGCAGAATTGGTGGCACGCGAAGATCTCGTC
CAAGTTGCGCAGAACCAGGTTCTCCGGGTCCAGGTACACCACGCGCTTGAGCACCGAGATCTGCGGGTCGTCCCAGATCACGAGCTTGTTGCGCATGTGC
AGCAGCTGCGTGCGGAAGTCGGTGATTGGCATGTGTGCGAACACGTTGGGGATGTTGGTGCGCACGATCTCCAGCTCCGGGTCGTCCTCCTTGAGCGCGC
GCTCGCTGTTCTCCTGCAGTCCGTCCTGCGGCACGATCACCATACGGCGGTACTTGGTGCCCGAGTCCTTGATGCTGCGCATGAGCACGCGTGTGCCTAG
CAGCTGCGCCTCGCTGTCCTCTCCGAAGTCGTACAGGATGGTGGCGAACGCGCCCTCGTTGGCCTCGACGACGCTCTCGGGCGCCACCGTCGCGGGGGTC
CTGGACTTCGTCTTGGAAGTCTCGGCAGAGCAGCAACACAAAGACAGGGCGACGACGAGCAGCAGCATCGAGAGAGCGCCAACTCGCCGCGGGCGCCTGG
CGCCATGCACGCGCAACGGTCTGACCCCCATCGAGGAGAAATGGCTGACCCTAAAAGCGAGGAGCTCTTGTAAATATGTGGGCCACCTATAAGATACATT
CGCGCAACCTCGGACTTCAACTTGGCAAACCGACACCGGACAATATCCGAGTTCGACGGGGCTGAACACGGAGCTGATCGAAGTCAGGAGCCCTCAGGCG
TGTATCTCATTGGGGTCAGCACTGGCGGTGAGAAGCCTCGTAGTATCTGGTAGATACATGCACTATACGTGAAGCGCTGTCACTGGCATCATTTTTTAGG
TCGTGCTAAGTTAGCAGCTAACACCCGAACGGCATTGCATCGGGCCGACCTGGTTGCCTTTCCCGCCGCCTTCCAGGCGCGTTCGGTGCACTTTGAGATC
CACAGACGTCAGTCGA