Description :
From Genome Similarity Track
Location :
Scaffold_1600:52- 4019
Transcript NameFunction/comments
Phyta_totarag13331hypothetical protein
Phyta_totarag13332hypothetical protein

Sequence
3967 bases(100 bases per row)
AACAACACATGGCGGTATTGCTGGAGATCACATCGACGAAGGAAGAAGTCAAGATCGAGGATATCCAATCGGTAAATCCTGAGGACAATACGCCGGAATA
GATCGAGCGACTGCTGAAGATCATATGGCGTTGCTGAGACCTTTTAATTGGGAAAGGGAATGCCTTGGCGCCGCTGTGAAGGGAGCGATCTGCGACATTG
ATGTGGGAATGCAAAACCAATAGCCCAACGGGTCCGCAAAGTCGCTCCACAGTTCCGCTATAAGTTGTTCCAGCTGATCAAGGGATTGATTCAGCCGAGA
TCATTCGAcactcgacgtcgccatgGGCGTCTTCGATCGTCGTAaccatcaagaagaacggagTCGACATCATACTCTGTATCGATTACCGCCTGATCAA
CAGCCTGACTCGATTGATGGCGTACCCTATGCCGCTTATCAACGACCTACTCGACGATCTTGACAAGATCCTCTGGTATTGCTCGTTAGAGGATTTTGGG
TGTCTCTATGACTGATCGAGCGCGCGCGATCTCGGCGTTTACTACTCCGTTCGGGCTGTTTGAATGGAATCGAATGCCGTTCGGGTTGACGAATGCGCCG
CAGATTTACCAGAGACTGGTGGACAACGCACTGTATGGATTTCTCAAGATCACGAGCAACCAAGATCACGCCACCCAGACCGACGTATTCGAGGAGGGAG
AGCCTGACGTAGAAAAGGAATTGTCGGTGCTAGGTCGTCGATCTTACATCGCTTACATCCTTGTTACGGCAGATTCGTAGAATACGTTGTGCGAAaaagt
ggagaagctgctagATACCTGTGACGAGTGGAACTTACCAATCAGTGTTGCCAAGAGCTTCTGGGGTATACGCAAGGTCGACTACCTGGGCCATCAAGTG
TCTGTAGACGGACTGGAAGCTCACCCGAAAGACCTTTGTCGCTGACCGATCTGCCATTTCCGACTACGCTGAGATCGATGCAGTCGGTTTTGGGGAGTCA
ACTATTACAGTCGCTTCATTGTGCACTTCGCGGTCTACGCGTCGGTCCTGTACGAGCTCCGAGAGGCCAATTTACATGAGATGGCGCGAAGATCGATACT
GGACCTGGCATCTGGGCTAGCCAAGAACGGTGAAGATCGATCCACAGATGACGATGACAAGTGGAGTCGAGTTGTCACGGCCTTCACCGTATTGAAGAAC
AAAATCGCGACAGCACCAatcttgcagcacttcgatcCAGATCGAAGACCGGTGGTGGTAGTAAGTGAGCGATCGCGGCTGCGTTAATGCAAGAACACGA
GGGCGTATTGAAACCGGTAACGTTTACTAGCCGGACGCTCAAGCCTGACGAGATCAACTATGGAATCGTCGACAAGGAGGTTCTCGCGCTGTTCAGGATC
TAGGATGTCTGCTATACGCCGTTAGTGACGAGATCGGTCAAGTTGCTGACTCGACACTCCACGTTGGCGTGGCTACTGCACTCATCAGGATTGCAAGGAC
GACTCGGTCGCTGGgccgcgctgctgtcgagctGGACTctggagatcgtcgagtGCGACAAGGGCGAGATCTTAGGCGTGATGGACGTGAGCATCACACC
GCGTGAAAAGGTCGACGCGATCTTGGTATCGATAGCACCCAGGAAGCAGCCTCGACAGGTGATCACCATGCCGCCACCTACAGTGGAGGCGGACGAAAAG
CTGCTAGTGGTCAGCTTCGATGGATCGGCTCAAGTAAattgaagtggagaagtGTACAGTGCAATTGAACGGAGTCTACCAGAATGGAAAGTGATCTCAG
CTGCGTCGCAGTACAAGGCCGATCTGACGGTCAACGAGGCGGAATACCACGGTTTGCTGCTATGCTTCGTTCTTCTGGCCGACCTGGACAGGGGACGGCT
AATTATCTGCGGAGATTCGAATTTGGTCATCCGACAGATGCGAGGTGAGATCGAGTGCAAGGCGCCAGGGTTGAAATTACTGCGACAACAGGCTACGGAG
CGCCTGAGATCATGGCCAAGTCACGAATTCCTTCATATGAAGCGAGATTGGAACCAAAGCGCAGATCGACTCGCTGGTGCCGTTCTTCAGCGTAAAGGAG
GCACGGTAGTGACGTCGGAAAATGAGTTCCAAGACTTGATGACGCTTAACCGTCTCGACGAGATGCTAGTTCCACGATCTGACAGCTCCGTGGCCAAGAT
CACCGCCGTGACGAGATCGCGCAAGCGGCGCAGTCCGGACGTCCTACAGGAGGAGATTGTTCAGTGAATGAGGGAAGAGCGGATTTTCCTGgcccaagac
gaagaaaagtgGATCGTCGATCTCAAGCAGTATTTGCATAGGGACGTACAGGATCTTACCTCATTAGAAGCTAAGACCTGCGCTAAGATCGCTGATGATt
acgagatcgacgaggctGGCTTGTTGTTTTACTGTCCGCCGTCCAAGCAATCGAATGAAGATCGCGATCTTGTTGCTCGACTGGTGATTCCTGaaatgct
gcaagaagaCTTCCTACATCATTACCATGTCAGCCTGGGAGGTGGGCATCAAGGTATCGGGAGGACATACCATCGGATCAAGGCGCATTTCCACTGGAGA
GGACTGTATCAGAGTGTGCAACGTTATGTGGGTCAGTGCATAGACTGTGAGACTGGAAAAATGAGGCCAACTGTTCGAGGTGAGTCGCCGGGCTACCCGC
AGGCGGCATACCCATTTCAGATTATTGCTATGGACCACATCCCGTTGCTGCCTCGATCTTACAAGGGCAACACGGAATTGTTGATCTGGGTCGATCCCTT
CATCGGTTTCGTGATCGCCAAGGCAAGTACATCAAGAACGCTCAGACGATTGCGGAGAATTACGAGGAGTGCGTTTTTCCGAAGATTTGGCGCAAATAAA
GCAATCCGGCACGATCGAGAGCCAGGCTTCATGTCTGACTTCTTCAGATCGTTCAACAAGATTATCGgacaacagcaacgatgtATCGTCCACAAGCGAA
CGGTACGGCTGAACGAAAGGTGCAGACACTAACGCGAGCGCTGAAGATGTACGTCGCAGACGTCAACCAGAACGATTGAGATGAGTATGCAGAGCACGTT
TGCTCTCAACACGGCTCACGATCGAGTACACGCCTTTCTATCTGGCGCATGGATGGGACCCAAGATCAACGCTGGAAGCGATGATCCCATTAGGATCGAC
GCGGCGCCGAGATCGCGACCCTCGAAGGTGGCGATACCATGTTCAGAAGCATTACCAGCAGGCGCGTGAGCAAGTGAACGAGTACCTACGCAAAGCTATC
CAGACCAGGGCAGATCATCCTAACGACTCTGTGCGTCCGCACGAGAACAAAGCCGGCAACTAAGTCTGGTTGCATTTGGACAGGGTGAAGAAAGAATACG
CACGAAAGCTAGCGCACATGTGGCACGGACCATTCAGAGTagtcgagaagatcgacgaatACGCCGTGCGACTAGAGATCGCTGGCACCGCGTACAACTG
ATTCTCCGTGATACACGTGTCGAAGCTTAAGTCCGTGCGAGACTTCCCCGACCGTCCGCGTCTTCGACTAGCCGcccaagatcaagatcgataaGATTTT
GATGAGGccctgctgcttgaagatAGCTAGGAGACTGAacttgacgaagatgagtACGAGGTCGAACGCATCACCGAAGTGCGATCTGGACGACGAACAC
GCTACGGACGAGCGCTACGCGAATTTCAAGTGCACTGGAAAGGCTACACCGAACCAACATGGGTGGACGAAGCCGATCTTAACTGCGGAGCTATATTGCA
CGACTACCTGCGCGAGCAGGACAACCGGAACCGGTTTGAGGCCATGCAGTCGCACGAGGAGCAGTAAGCTGGCAAGATCGTGGAGTGAGTTGGTCACTCC
ATGAGTGGTTGGGTAAATCTCTGCGAGGAGGTCGCAGATCAGAAGGAATGGTGAGATCGTAAAGTGA