Description :
From Genome Similarity Track
Location :
Scaffold_2206:52- 2860
Transcript NameFunction/comments
Phyta_totarag14243hypothetical protein

Sequence
2808 bases(100 bases per row)
AAAGGAGTGACAGCGTCACCGTTCGCCTGGCGACGGGGGATCGTGTCACGGTGCCTAAGGTCGCGGTAGACCTGGGCGCGAAGTTCCTGgacttcgacag
catggaGCGCTGTCTGGCCCTAGACCTGGATTCGAGGTACGCCCTCATCTTTGGCATGGCATGGATCGAACTCCATGAACCATGGATCGACTGGAGGTCG
AAAACATTAGGTGCTACGCACTTCTCTCTTGGTGGAGCATTGGCGAGTCATGAACCCACCTCTGCTAGGAAGCGGAAACGCTATTGGCGCGGGCACTGGG
CCGAGCCGgccatggtgctggacatcGATGTATCCGAGTTGATGGACAACGCTGTTGTCGGGGATGTATGTCCCGAGTACGGCTCGAAGAGCTTGATGTC
GAGGGGTCCGAGCAAGGCTTGCCGGACCGACGTGGAACGGAACGTACTCCGTTGAGTGGTGAGCGTCGGCATGACGCACCACTGAGTGCTCACTTGAGCA
ATATCGACAGTGTGTCGAGGCACCCCGGACCCAGTCCGGACGGTGCGCGTGTGGTGGGACTGCTTCCCCCGAACCAAGGGCGTCTATCGCCGTGTGTCTT
TGAGGACACGGGTTCCCACGGGAACGGAGGTGCTTCCGCACCTGGGCTGAGTGACACTAATGTCGCTTCGTCGCCCTCTTCCACCCGGTCTCGGGcgcgg
agaaggaggaggatgagACGCAGAGCGTCTGCaacgtcgtcggcgtcggacGAGGTGTCTAGCGTGTCGAGCAGCGCTCCAtgcgactgcagcgagcaGT
TGTACACACTCGTGAACGGAGTGACGGGAGAAGTCGATGGCGACATCAGCCTTGAGGCTCTTCCCACTGTTGACGctcttctcgagctggacgagatgtc
catcgccgagttcggcgaggCCTTGAAGGCGGGCGATTTCGCTGAAGTGGTCATGATACGACCTGAGGAGGAATTAAACTCCTCATCCCTCGTGGGCGAG
TCTGTCCTCGAGGAtaccaagaaggcgctcaatGCGCGCAGTGAATCCGAGATCCTTAAGGATCCCTCAGACCCGTTCTATCCATTGCTGGTAGAGTATA
GAGACGTCGTCTTGAAGTACCCGCCTATGGGTCTGCCACCGgatcgacgagttcgtcaCAAGATTGACTTGGTTCCGGGAACCAAATACTGCGTGACGAG
GCAGTGGCCTCTGCCAAGAAAACAGTGTCTTTCGTGCGAAGCACGAGGCTGGTCTGGTGCGTGAGAGTAAGTTTCCACACTCTACACCAACATTCTGTGT
CAGAAAGCCGAACGGCAAGTGGCGCATCGTACATGCTTTCTACAAGTTGAATGCAGTCAATTCCGGCGCAGACGCCAATTCCTCGGAAGGATGTTCTCCA
GAACAGCATGGTCGGCTGTACGCTGTACAGCGCCCTCGACTTGGTCGATGGTTACTAAGAGTTGCTCATGAGAGCGAGTGCCATTCCACTGACAGCCGTA
AGCACTCCGAGCGGCATGCTGTGGGAGTGGCTGGTGATGCCCCAAGGACTGTCGAACGCACCGGCGACGTTCAATCGTCTAGTGACGCAGTTATTCCGGC
TCCATCGGGTGTATGCACAGACGTAATTTTGATGACATATTAGTCCATAGTCGTGCAGGGCACGGGAAGTCAGATGTGGAGAACCACGTCGACCATCTac
gagcagtgctcgagtGCATGCGCACCAGCAAGTTGTATGCCAACGCTGACAAATGCGTCTTCGGCGCGGAAGAAATTCCGTTTCTTGGGTGCTTCATTGG
GAAGCGAGGCCTTCGAGCGGATCCCGCCAAGGTTAAAACCATTGTAGACTGGCCGGTTCCAAAGAACCAAAAGGACTTACGCAAGTGGTTAGGCCTCGCT
AATTACTTGCACAAGTACAGCGAGAATTATGCTGAGATGGCAAGGCCATTGTCGAATCTCCTTAAGAAAGATGCTGAGTGGTGTTGGGACACCGAGCAAC
ATGGCGCCTTTGAGGCGATTAAGGAGAGCCTCCTTCAGGCGCCGATCCTGGCGCTCCCGGACCCGGACTGTCCGTTTAGCGTCGTGTATGACGCGTCCGA
CTTCGCTATCGGATGTGCATTACTTCAAGCGGACTCCGAAGGGCGCGAACGCGTGGTCGCGTTTGAGTCTCGGCAGctcaaggctgctgagaagaACTAC
CCAGTTCACGGCAAAGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCAGGGTCCACCTGCTCGGCTCCAAGCCTTTCGTGGTTTACACGGACCATG
CGTCATTACGCACTGCGACCCAGTCGCCTCACCTCTCTCAGAGAATGGCCCGATGGCTCTCCTTCTTTGTGGAGTATAACTTGGAGGTGAAATGTAAGCC
GGGCAAGCAGAATGTCCTGGCGATGCGTTATCACGCAGACCGGACTATGAGCTTGCTCATGTTACGACTGTGACATCGTCCGTGACAGACTTGATTCGTG
CAGCTTACGCACCTGACGGCACTTACGTAGCCCTGCTACATGATCTTGGGAGCAAGGAATTCCCCGATTCAGACAGGAAGATGTCGGCGTGCTCTCGCGC
GAGGTTACATCGATATACCCTCGATGATGGCCTGCTGTATTACAGCACAAGCTCAGCTGACACGCCTCGCGTGGTGGTCCCTCATGACGAGGACTTGAAG
TATCGCATCCTCTATGAGGCCCATGATACCCCACTCGGTGGCCATCTGGGTCGTGAAAAGACCTACAGCGCTGTCAGCACGATGTACTGGTGGCCGAAGC
TGTACANG