Description :
From Genome Similarity Track
Location :
Scaffold_923:52- 2805
Sequence
2753 bases(100 bases per row)
CCTACTCCTCTTCATGAGACTACATCATGCCAAATCGATTCCGATTCGTACGATTCCGCAAGAATGCATAGAGTAATGCTCCACAGTTCAGATCCGCCTC
GTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATGCGCGGTAAATTCGTCCATATCGGGTTCGCTTCCCTGGCCTCATTTCGGCGATT
CTCTCGACTTCGAACTCGTCAGCTTCGAGATTGACGCTTCAACTATCCTCCGGTAGGAGGACTTCGTCGAAATCCACTCGGTCGGATTCATCCACCGAAA
GACGGATTTCAGGCCTGTCCGTATATTTCCTGACCAGCTTCAGCTTGGATACGTGTACCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTT
TACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGGTGGGCTAATTTGCGGGCATACCCCTCTTTCACTCGATCCAAATAAAGC
CACACCTGCGATCCCACTTGGATTTGAAGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTTCATAACCATTCGTTCACTTGGG
ATCTGGCGTGCCGGTAGTATTGCTTGCCTTGGTATCGCCATCGTCTTGGATCTCGGTTCCCCTTCTTGGTGCTACATACCGGAATGGCTGCTTCTAGGGT
GAATTTAGGATCCACTCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCAT
CCCAATCCCTCTGATCCAAATTCTGAACATACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCAGATCCATTGTCTTGGGAACGATATTC
CATAGTTGCCCCATGTCTCTGCCCCAGGATCCGGTTGAAGGCTCAAAAGAAATCATACATGAAGCCTGGCTCCCGATCATGCCGTATCCTCTCAGTAGCC
CCACATCTACGAAAGATACACTCCTCGTACGATTCGGCGATGGTCTGTGCGGCTCTGGACGCGCTAGCCTTGGCTATCACGTATCCGGTAAACAGATCCA
CCCAGATCAACAACTCTGTGTTTCTTTGAATGACTTGGGTAGAGAGGGGATGTGATCCATGGCTATGATTTGGAACGGGTAAGTCGCCTGGACGTTCCCT
GGAGACTCCACTTCGATTGTGGGCCTGCCATTGCCTGTCTCAAAATTCATACATTCACGGACATATCGCTGCACACGCTTGAATAGTCCCCTCCAGTGAA
AACATTCTCGGATACGTTGATAGGTCCGATCTAATCCCTGATCTCCTCCTTCTAAGCTAGCGTGATAGTGATGTAGAACGTCCTGTTGCAAGGTTTCCGG
CATCACCAATCTCATCAATCCGTCTCGATCCCCACTGACTCGTTTCATAAGAGGCCAATAGAAGAGCAAATCGTTCAGATCCACTGCATAATCCGTAGAT
ATAATACTATAGGATTTGGCGTCCTCCTGGCTCAGGTCGCGCTCATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTCTGTGCTT
TGAGAATCCGCTCAATACGGACTTACTTCACAAACGCTTCATCTAGGATCTGGGGGCTGGATCCAACCCTTCCTCTGGATCTAGTGACAGCCATTACCTG
GACTGTCCTCTTCACGGATCCAACCACCACCACTTCGTCTAGTCGGTTTAACGTGACGAGATCCTGAAGCTCGTCCTCTCTCTCCACCACGACACCACAT
TGATTGCGTAAAGCGGCACTGGCCAAGCTATCCGCACTGACATTTCAATCTTGCTTGACATGTACCAGCTCGTGATTCATTCAACCACATAAGTGGACCA
CCACCTTCTGTCGTATCAGCGATAGGACCGGGACCTTGCAGTCAATTTTGCCTCGCACCTGTCTGATCACCGAATTCGGATCTCCACATATCACCAGCCT
TTTCGTATCCTCTTTCTTTAGTAGATCCAACCCCAGCAGAAGTCCGTTATACTCTGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCTT
ACCACTTCCCATCCGGGCAGTTTCCACAGAATTGCGCTGTATGATCCTCCTCCGCGCCGCACGTGAGCTGATTCATCGAAACTCAGGACGTACAGATCTT
CATCCACTTGTACCGTCGGAATCGATCTCTGGATCTGACGTTTGGGCTCTTTCTTAGGGGCCATCCTAGCCAGTGCTTCGTCCATCTTGACTCTGGGGGT
GATGCTCGCGGCCAAAATGCATCGGATCTCGTCTTCTTCTTTTGAACATTTTACGATCTCCAGTGTCCATGGTGAAAGTAGGGCTGTCCATTGTCCCAAC
CGTTCTTACAGACCGGTCGACTTAAACAACCAGACGAGCGTGGAATGTCGAGTCAAAATCCGGATAGATCTTCCCGCCAGCAGGTTATATTTGAGATCCA
ACACCCGCAGAAGTGCGAGTATTTCCTTCTCCACCTCTCCGTAATTCAACTCGTTCGGCTTTAGCGTTCGGCTGACGAAGGTGACCGGATGGCAGATCCC
CTAATGTTCTTGTACCAAAGCTGCTGAGACCGCCCAATCACTAGCATGACCTATCACCGTAGGTTGACACTCCGGATCAAAATGACGGAGGCCGGGCGTC
GTCGCGATCCTGTTCCTTAGCTCCACGGACGCGTGTGAGCTCGGATCCACCGA