Description :
From Genome Similarity Track
Location :
Scaffold_29:52- 2070
Sequence
2018 bases(100 bases per row)
CTCGTAGCACTCATCACCGATTGGAGTCTTCGTCGTGTTGGCATCGGTCATGCCATGCGCACGCAGCAGTTCTTTGATCGCTTCTTCTTGATCAATGCGG
TAGCTGCCGTCGTCGCCAAGCTCGACACGCATGCCGAGAAACTTGTGCACGCGGTCTAAGTCCTTGATCTGCAGTGTAGCCAGACCCTCAAATATCTTCT
CCACTGCCGCGGCGCTCGTGCTCGCCGCAAGTAGATCATCGACGTACACACCGACGACAACAAGCTCCTCGTCGTCACGCCGAAAGTATAAGCACATGTT
GGTAACACACCGAACGAACCTAGCGTCCGTAAGCCGCGCATGGAGCAGCTGGCTCCAGAGGCGTCCCTCTTGCTTCAAGCCATACAGGCTCTTGCGAAGC
TAGAGGACGACCTCACCAGAGTTCGCAGCGCCGAGCTCGCGCAGTGTGTCGTCGGACACGTCCATCCCGCGCGGCACTTGCAAGCAAATCTTGAGGTGGG
CTTCCTTGTCCGCCTTTACGTATGCGTTTGGGATGTCGCCATCTTTGGCTGGCACACCTCAAAATGCCGCGAGCGCTAGCACCACCTTGACAGTGCTGAT
GTCCATCTCCGCCGCGAACGTAAGACTGTAGTCCACGCCGAGCACTTGCTCGTTGCCATACGCAACGAGCCGTGCTTTGTGGCGTTTTATCTCGCCGTCG
GCTCCCGTCTTGGTCTTATAGACCCATTTTGAGTGCAGCGGGTTCGATCCCACGCTTCTCTTCGTCACGCGCCAGACGCCGTTGTCCTGGAGCGCGCTAA
TATCCTTGCGCATTGCGACCTCCCACTCCGCGCGCTTCGAACTGCGCATTGCTTCTGCATAGTTGGTCGGTCCTTATCGTACGCGAGGTTGACGACGTTA
GGTATCGCCGTCGGCTCCTCCAGCTGTGCCACTGATTTCGGCTCTCGACTGCGTCGCTTCCGTTTCTTCTTGCGCTAACTCAGGTGACGGGACCGGGTTC
GTCGCACTCACGGCGTCTCTGCGCACGACAGGGTCACCGATTCCGCGCAGCAGTCGTTCGTTTTGTTCTGCTGACAGCGTCGCGATGTTCCTCACGTGCT
GCGTCGTGATGACGATGTTGCTCTTTGGGAGGTACACTCGGTAACCCTTCGTCTCATCGTTGCGGCCGATGATCTGCCCTTATTCCTATCGCGGCGCCAG
CGAGTTCTTGCCCGGGTCCCGTCGTACGTCGCACGTAGACCCGAAAACGACGATGTCACGCAGATCTGGCGCGGTCTTCACTTTGTACGGAGATGCGCGT
CGCTCGTTCGCGCTCTTAGGGCTGCAATTCAAAATGTACGTTGCATAGTCGACAGTGTCACCCCAGAAGAAGAGCGGCATGTTGCACGCGAAGATCATCA
CCCTCGCCATGTTCAGCACAGTCTTGTGCATTCGTTCTGCCTTGCCGTTGCTTGCCTGATTGCGCGCTTCGCTGATCTGGCGTGCGACACCCGTTCGTCT
GGCAGAAGTGGTCGACGTTTCTATACTCACCTCCTCCTTCGGTACGCAAGACCAGAATCTTGCATCCGAAGCGTCGTTCGAAAAACGCCAAAAAATGTTT
GAATTTCTTGGCTGCTTGGTCCTTGCTCTTGGCCAAGAACACACGACAGTAGTTGCTTTTGTGGTCAACAAAGTTGACCAAGTAGCGGTTGCCCAAGCGG
TCATTCGGCATCAGTGGACCTTTTAGGTCCGAGCAAATCACTCTCCTGATGCGCTCAATTGGCGAGTTCGCGCCGCTGTCCTGATGGCTTTGCGCATTCT
TCGTCTGTTTCCTCTGCATGCACGTCACGCATGTGAGGCGACGACGGTCGATGAGCTCGATGCCAGAGTCCGGGTTGCGTGCAATGCGCTTAATCGTGTC
GTACGATATGTGCCCGAGACGTTGGTGGAAGTGGATTAGCGATACCACTTGCACGTCTCTCGCCGGATCTATCGCAACGTCGTCATCTGTGAGCACCACC
ATGATCACGTCGGCTGCT