Description :
From Genome Similarity Track
Location :
Scaffold_1752:52- 2041
Sequence
1989 bases(100 bases per row)
AAAAGATTCCCTTTATGGGGTGCTTCATTGGAAAGCGAGGCCTTTGAGCGGACCCCGCTAGGATAAGGGCCATAGTCGATTGGCCGGTTCCAAAGAAACA
AAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTATAGTGAGAATTACGCAGAAATGGCTCGGCCACTATCAAATCTCCTTAAGAAGG
ATGTGGATTGGTGTTGGGGCGACACCGAACATGAGGCTTTTCAAGCAGTTAAGGAAAGTCTCCTTCATGCGCCAATACTGGCTTTGCCCGATCCTGATCG
GCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGCCATAGGCAGTGCTCTGTTACAAACAGATGTCGATGGACGCGAACGCGTCATTGCATTCGAATCT
CGATAGCTCAAAGCTGCTTAAAAGAACTATCCAGTTCATGACAGAGCTACTTACTATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTGGATCA
AAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTATCTCAGAGAATGGCTCGTTGGCTTTCATTCTTTGCCG
AATACAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAATGCTTAGGCTGACGCGCTATCCTGACTATGAGCTTGCTCACGTAACTACGCTGTCATCGT
CAGTCACTGACTTGATCCGTGCGGCTTATGCCAAGAATGAACAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCGAGGAGTTTAAAGACTCGGACATAGA
ATTGCCGGCACGTTTATGCGCGAGGCTACATCGATATTCTATCGATAATGGCCTGTTGTGCTATCGCACAGATATTGAGGATAACCCTCGTATCGCTGTC
CCTCATGATGAGGAGTTGAAGTATCGAATACTCTATGAGGCACATGATACCGCTTTATGTGGTCATCTCGCTCGTGAGAAGACCTATAGCTCAGTGAGCC
AGGCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAACGGGTGAAACCCTCAGCACATGCGGCGGCGCC
GCTGCTAGTCTGTCTGTACCCACTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGAGGGCAACACTGGAATTGCGG
TCTTTGTTGACCGATTGAGCAACATGGCTCATATAGCGGCAGTGCCGGACTCTATTGATGCCGAAGGCACAGCGAAGATGTTTATCGACCGTGTGTTTCG
ACAACATGATTTGCCAGTGGCAATTGTCTCTGATAGAGATCCTCGCTTCACTGGCAAGTTTTGGAAGTCCATCTTCAAGGTGCTAGGTACCCGTTTGGAC
ATGTCCACAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCGTGTTAATCGCGTCATAAATGACATTTTGCGCAGTGTTTGCGCTGATACGCCTATGC
GTTGGAGCTCTATGCTCCCTGTTGTTGAATTTGCGTTGAACAACGCTATTCATACCCCTACAGGCTATACTCCGTTCTACGTAAACGGTCTCATCCACCC
TCGCGTTCCGTTAACGCTACCACTATGTGGTTCAAGGCTTGGTGGAGGAGAGGTTGCCGATCGGCTTGCTGATATCAGCCTGCTACTGTTCAAAAAAAGG
AAGGCAAGTTTCTCGCAACCGATTGAATGTCTTAAAACATGTGCGTGACACAATGGATGAAAACCAACACCAACAAAAACGACAAGCACATGCTAAAAAA
CATAATTTATATTGAACGTTATCAGGTCGGATACCAAGTATTACTCAATGCTAAAAACTTACCTACAAAATGTAATGTCCGCGGTCTTCAATACAAAGTT
GCGACCGCGCTTCGTTGGACCATTTCACGGTCGGTGCTAAGAAAAGGACTTGCGTATTACGCTCATCTTCTACGCAAATTGCGCACACA