Description :
From Genome Similarity Track
Location :
Scaffold_1220:52- 1912
Sequence
1860 bases(100 bases per row)
CAATGCTGTCGGCTGCCTGATGTACCTCATGGTTGTGTTGTCAAGAAGGCGTCTCGTCCAGCTTCGGCATACCAGTAAAACCGGTTTCCAAGGACCCCGC
GATGTTTACGGTAAGTCAATTGCGCAAACGGATGTATGCGCAAACAGATGATTGGACGAACAGGATGATTGGACGAGTCCAGTGCTGGTGATTGGATGCA
CCAAATGATTGGATGCAGACTAGGACGTAAGACAGAGTAAGCTCCAATAAATCAATCACTTTGCATTTTATCATCTAGTGCACAAACGACCTTCCTTTTG
GTTATGAGCCCAAGCCCCGCAGACTCTGCCCAAGACTACGCCTACGCCATGGACGCCACTTCAACGACCGCCCGCATCAACAAGTTCGACGGAACCAACT
TTCACACGTGGAAGTTCAAGATGCAGATGGTGCTGGAAGAGCGCGACATGTGGGAAGTCGTCAGTGGCGAACTGAAGATGGAGCACTGCGCTACCGCGTT
GGACCAAGCGACGTTCGAGCGGAAGTCGCGCAAGGCGCTGGCGATTATCTGTCTCGCATTGGAGGATTCGCAGCTGCCGTTGGTTCGGTCGGCGAATGGT
GCGCATGATGCCTGGTCAAGGCTGGAAGGACACTTCGAGAAGAAGAGTTTGGCGAATAAGCTCTTCCTTCGTCGACGTTTCTTCACCACGATGATGGAAG
AAGGTGATGATGTGCTGGAGCACATCAACAAGGTCAAGACGCTGGCGGATCAGCTCGACGCAGTGGGCGCTCCGGTCAGCGAGGACGACTTGGTGATCAC
GCTTCTGGCAAGTCTAAGCGAGTCGTACCAGTTCCTCATCACGGCGTTGGAGTCGAGATCTGACTCACTGTCGTGGGAACTAGTGACGGCTCGGCTGCTG
CATGAGGACATGAAGCGCAAAGAGCAAGGTGGCGGTGCGGACGGCGCCGCGCACGGTCAAGCGTTCATGACGAGTGACAACGGTAAGCGTAATAGACGAC
AGGCGCCAAAGACAAGCGCGTGTCACTACTGCGGCGAACAAGGACATTGGATCGCCAAGTGTCCGGTGAGGATTTGTGAAAATGCGGAGCGACAGAGGCC
GCAACGAGCAAACGTCGCGCGCGATGAAGAAGAATCGGGCGAGTTTCTCTTCTTGGCTGGTGGTGGGAGCAAGACCACTAAGTCAAGTGACAAGTGGCTG
GTCGACTCGGGTGCGACGAGCACATGACGTACTCGAAGGAGTACATGAAGAACTACAAGAAGATGTCTCCGGTGGACGTACATCTCGCGGACGATGGTGT
GGTTCAGGCAGTCGGGACCGGCGACATCGTGATGTCCATGAAGACTCCACGGGGGACCAAGAAGGGTGTGCTCACGAATGTGTGGCACATTCCCAAGCTG
TCACGCAACCTCTTCTCGGTTGGTCGCTTCACCAAGGATGTTGGTCCCGTGACGTTCGAGACGGATGGGTGTTTTGCGGAAGCAAAGGGTCTCAGCTGGA
AGCTCGGCGCGCGTGAAGGCAAAGGGCTGTTCAAGCTGTGCATGACACCAGTTGTGCCCGACGAGGCCAATGCGGCAAGCTCGAAGGATCGCAAAGGGGA
CACCACATCGTACCTCTGGCATCTTCGACTTGGTCACATTGGCCATGGCGGTCTAGACGCCATCGTCAAAAAGGACTACGGTGCAGGCATCAACATGACG
TCGGTGAAACAGTGGGAGCTGTGCGACGGATGTGCACTCGGCAAGCAAACGCGAGTGAGCTACATGTCCAAGTCACCCAACCACGCCAAGAAACTGCTGG
AAATCGTTCACAGTGATGTGTGTGGTCCCATGCAGACGTCGACATTCAGTGGCAAACGCT