Description :
From Genome Similarity Track
Location :
Scaffold_544:52- 1498
Sequence
1446 bases(100 bases per row)
AGAGCCGAATCAATGTCAACATGGCATCCGTAGCATTTTCGGTCCGGTATCTCACGAGCGTACCAAAATACTGTCATTTCTGAGCTTTATCGCCGCAAAT
TGACGCCGTTCAAAATTATTTCCTTGTCTGAGAAGCCACGGGCCGTGTTGGTTGTGACAATTTTACCGGTAGATGAATTTGTCCAGCCCCACGTCGTATC
AATGAGAACATCTAGTACCCCAAACTCCCCTTGTTGTTTCTTATCTCCGAGCATTAGCTCTTCAATAATAGCAGTCTTCTAACCCTACTTCGGCATCTCT
ACATATTCTCAGTCAGATTCCACCCACGCGCCATTATCCTTCGCCAAGAAGAGTCGCAAGTCATTGGCATCACACTATACCATATTCGGATTCTCAGGAT
CAATGACAAGCTTCAATTCACCGAGCAATGTTTCATTGTTAGTACAAATACTGGTGGTTTGCCACCAGCATTGGCATCTTCCAACGTGGCCTAAATTTCT
CACAGAAACTTCATATCTCTTCTCAAGGCGGCAGTGGAGAGTTTAATTACCGAGTTTTGATTGATTAGCTTTAACAGATACTGAGAAAAACCATTAAATA
AATTACGTTATTGAAACTTTTAGTATGTTACAGTACGAGTAATGCTGGGGAATCCCGTTGGGCTTTGTAGGCGCAGATGTTGATATATTAGTTAATCATG
TATCTGCAATATTTTCTCTAAGTAGTACGATGTCCATTAATCCTCACTTGAATACTACTCACCATGATTATAATAGAAACAGGTGGCGCCAACGGTCCGT
GTGATCTTGTGTCAGGACGAGTGACACCACACCCGAGTTAACGACACATCTTAGGTGGACGCTGCAGCACATCGGGAGCAGTGGTGGCACGGCCCGCCTT
TACCGCCTTTTCAAAAGGCGCCTAAACGGGTTTAGGCGAGGGTTTTAGGCGATGCGGCAGCCGATTCGCCTTTTGGTTAAGGCGCCTATTCAGAAAATAT
TGGTTGTTGTATTGCATACTTAATTTCAGTGACCGTAAAACTGACCTTTCACAACTAAAATCCCCCCGCCATAGCCAGCCCGTACTGGTACATGCTAGCT
TGTTTAGAACACCCATTGTTCTCTTACATCTCGTGCGCTTCGTGGTACTCAAGGTCTTGTAGGCGCCTGTGTGTGTTCTCGTTGGTACCTGTGATCTCTG
TGGCGCTTTTTTCTTGTTGCCTCCCGAGTTCTTAGCTCTCGTTGACGTTCTTTCGCTCACTGGCGCTCGTGTTCTCGCTGTGGTCCGTGTCCTCGCCGTG
ATCTCATTGGCGCTGGTGTTTTCTTTGGCGCTCAGGTACTCGCAGAAGTTCGTGCTCTCGTTGGCACCCGTGTTTTCGCTGGCGTCTGTGCTTCCGTTGG
CTTCCGTGTTCTTCGTGGTGTCCGTGAGCTCTGTGGTACAGCGTTC