Description :
From Genome Similarity Track
Location :
Scaffold_4194:52- 1381
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4194-snap-gene-0.0Cleavage induced predicted protein
Pytiw_DAOMBR242034maker-piw_contig_4194-snap-gene-0.1Cleavage induced predicted protein

Sequence
1329 bases(100 bases per row)
CACGCGGGTTGATAAGAAGTCTTCGAGAAGGTCAGGACAAAGGGCGGTACTTGATCGTGGCGTTTGATATCCAATCTCGATGGCGCCACGTCCGTTGCAG
CCCGCTTGGCGCCGTTGAAAAGAAAGGAGTCGACCCAAGCACCGAGGTACGGCTCATCCATGACTTGTCATCTCCCCTCGGCAACTCGACCAATCGCTGG
TTCGTGAAGGAACACGCGCCGTCGGTTCGTTTCAGCGCCGTCGTACTTCTTGCTCAACGAATCAAGCTCTTGGCAGCTCGACATCCACAGCTCGCAGTGA
AACTGAAGAAAGGCGACGTGAAAGGCGCATTTCGTCATCTGATGGTGAACGCAGCACACGTACACTGGATAGCTGCTCAACATCCAGTCCACAAGGTGCT
GATTATCGATCTCGCAGCGCCGTTTGGATGGACCGGTTCGCCTTTTTACTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCACGCGATCCT
CGCTGTTCTCGGGCCGCGAGCGATCAACGAATCCAAGTTTTCCAGCTGGAAGTGCGAGCTGTCCGCCCTGGGACTTACTTGGAATACTGTCACGCGCACA
GTATCCATTCCCGGAGACAAGATTGCAAAAGCACTTACAAGGACGACAACAATGCTGAACGCAAAGACGACGAGCAAGATCGAGCTTCTCCAGTTCGTCG
GTAGCCTCCGTTACATCAGCATTTGCGTCAGATCGACAAAACCATTCTTCCAGCAGTTGCATCACTTGAGCATCAAAACCCCCAGTTTTGGCAAGATCCA
GCTATCGAAGAACGCGGTCACCGACCTGCAGTGGTTTGAGCACATTCTCCAGCACGGATGGCTGGCACAGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCTCTTCGGCGCCGCTC
CAGCTCCAGATACCTGCCTGTACATGGAC