Description :
From Genome Similarity Track
Location :
Scaffold_552:52- 1310
Sequence
1258 bases(100 bases per row)
ATCCATGATCTTCTCCACTTCATACTCGTCATTCTCGTTGTCCGCTGCCCAGCTGTCTTCGGGAAGAAGTGCTGTGTCAAAGTCATCGTTGTCTTCGATC
TCCGGTTGGATTATAGGCCGTCTGGGATACAACGCCCGGGGTTTCAGTCGACTGATGTGAACCCAAGGGTTTACACGGTAACCCGTGTCCTCAACCTTGA
GCCTCACCCGGAACTCGTCAACCACTTCGGCGATCCTGAATGGACCATGCCATAAGTGGGCCAACTTTCGACTCAGACCCGGCTGCACTTTTGGGATGTA
CAGCCAGACTGCATCCCCAACGTTGAAACCTGCCTTGAGCCGGTCTGACAACTCGTTGCACTTCCGGGTTTGCTCTTCCGAGCGAGCCCGTTTGGCCTTC
CTCTGGAGGTCTACTGCACATGCCCGAGCGTAGCCGTAGTCCCGCTGGAGTTTCCTTCGCCACTCATACGCGGTCCGTTCAGGGACACTGGAGGGTTTAG
GCCCCAGCATAGCTGAGATCGTACTCTTGGCGTCCCAACCGTGGACCAGGTAGAATGGGGTGTCCAGCCGGGTTGCATCAAACGACGTGTTGAGCGCGAA
CATGAGTCTCTCTGCGGGGTCATCCTAGTCGCTCTGGTCAGCTTCTGCGATGTAAGTCCGGATGGACCTCGCCACAGTCTGGACGGAACGTTCCTGCTGT
CCATTCGCCTGGGTTCGGTATGCCAACGTAGCTCGCTGTCGGCTACCCAGAAGTTCCCTGAACCGAGTGAAGACTTCACTCATGAACCTGGGATCCTGAT
CGTGACGCAGTAGGGAGCTGGCTCCGAAGCAGCGGAACACCCTCTCCTCATACGCTTCAGCGACATCCTGACCGGTGGTAGAACTCATCGGTTTGCACAT
AACGAAACCCGAAAACGCATCCTGGAACAGGAGCAAGAACGTGTTACCCCGTTCGGACTTCGGCAAATGGGTCATGAAGTCCATCGAGACCACTTCGAAA
GACTCTCTGGGCTCGATGTTCCCGGGCGAAGGTCCTGGATTCGGCGGACGCCCCTTGCCACTGGCGCAGTCGGTGCACTACTTGACGTATCTTTCAACAT
CTGCGTACATCCCTGGCCAGTAGAACTCCAGCCGGAGTTTCTCGTGCGTCCGGGTTATTCCCTGATGGCCACCTTGGAAATCCTCATGAGCGTAATCTGC
AACATGTCCAGACGGAGTGCTTCCGGTACGACTAGGCGCAACTCGTCGGTCTTGTCGC