Description :
From Genome Similarity Track
Location :
Scaffold_799:52- 1300
Transcript NameFunction/comments
g16487.t1hypothetical protein

Sequence
1248 bases(100 bases per row)
GCGTGTTCGCACGGCTGCCACCTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAGAGGGGAGACACGAGGTACACAAC
GATCTGGGAAATGACTACATTAAGATTCAACGTGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGACCGGGAGCTATTC
CGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCAC
CACGAACGCGATAGTACATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGACCAGCTCGAGAATATGTGTCCACAGACTCAGTGGAGGATGACGAG
GACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGA
TGGGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCACGCCACCATCATGGCCGGCGA
CAGGCAAGGCCATCATGTGTTGATCCCGCGCATCGTGTTCATCAGTGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATC
CAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGT
ATGTGGCCATGTCGAGGGTTACGTCGAGGTCGAGATTCAAGGCATTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGT
GTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACACATACTGAGCATACGACGGAAGCGGAGTACGCCTGTGGTTTGAAGTCCGTTGTGCGAACACGC
GGTGAAAACCCAGGACCAAGCAGTGCAGTTGCTAGATAATGCGGAGGCGAAGCTTGCGAGCCTGTAGCGGCTTAGGGTTCGACAGCTGGAACCCGACGTG
AGACGAACTGGAGCGAGTATCGGCTGTGTTTGAAGTCCGTGGTGCGAAGCACGCGGGTGAAACCCAGGACGCCAAGCAGTGGCAGCTAATGACAAACGCG
AGGCGAAGCGTTGCGAGCCGCAGCGGGCTTAGGGTTCGTACACACGGG