Description :
From Genome Similarity Track
Location :
contig_149:51997- 53052
Transcript NameFunction/comments
g13837.t1hypothetical protein

Sequence
1055 bases(100 bases per row)
CCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAGGTGTGTGTCCTGTCGAGACATGCACC
GAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCCGGTCCATTGATGGAACGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACG
CTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACGGACAACTGCATCCCAAGAAGTGTAAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCG
GATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTAC
TGCAGCAAGATGGTGCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAA
ATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGT
ACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGT
GGTACTCATACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTG
TACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCC
GCATCATGTGCGTATGCGGCCTTCACGTCGTCCAACAAGGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGC
GCGTCGGCTACGACATTCAACCTTCAGGTTTGTACTCAACCTGGAAGTTGTATTC