Description :
From Genome Similarity Track
Location :
scaffold_568:5199- 7486
Transcript NameFunction/comments
Pl_103769propionyl coenzyme A carboxylase (Pi-PCC1)

Sequence
2287 bases(100 bases per row)
TCTGCACGTCTGCTACGACGTCAGCTCCTGTCGCGTCAGACGCCTGCGGCCTTGCGCCAGCTCCACGCCGCCCCCAAGGAGAAGCTCTTCGACAAGATCC
TCGTGGCCAACCGTGGCGAGATCGCCGTGCGCGTCATGCGCACGTGCAAGAAGCTAGGCATCAAGACAGTGGCTGTATACTCGGAACCGGACGTGAACTC
GGTGGCTGTACGCATGGCCGACGAGGCTGTGTGTGTAGGGCCCGCGGCCTCAAGTCAGAGCTACCTGAGCATCCCCAAGATCGTGGAGGCTGTCAAGGCC
ACAGGCGCCCAGGCCGTGCATCCAGGATATGGCTTTTTATCGGAGAATAAGGACTTTTGTGAGGCACTGGAGGCTATTGGGGTGGCCTTTATTGGCCCTG
GCCATGAGGCCATCCAGGCCATGGGCGACAAGATTGAATCCAAGCAATTGGCCATGGATGCTGGGGTTAATACGATCCCGGGCTTCCTGGGGGAGATTGA
CACGCCCGATGAAGCGGTTAAAGTGGCCCAGGAGATCGGCTATCCGGTTATGATCAAGGCTAGTGCGGGCGGAGGCGGCAAAGGTATGAGAGTTGCTTAT
AATGATGAAGAAGTACGTATGGGCTACAGATTGTCGAAGGAGGAAGCGGCCAGCAGCTTTGGAGACGACAGGATGTTCCTAGAGAAGTTCATTGAAGATC
CCCGTCATATTGAGATCCAATTGATCGCTGACTCACATGGAAATGTGGTGCCGCTACCTGAGAGAGAGTGCTCTATTCAACGTCGTAACCAGAAGGTGAT
TGAAGAAGCACCAAGTGTGCTGCTCGGTCCGGAGACGAGAATGGCTATGGGCAAGCAGGCTGCCATGCTGGCCAAGAAAGTGGGGTATGTGAGTGCTGGT
ACGGTGGAATTCCTGTGTGATAAGCACAAGAATTTCTACTTCTTGGAGATGAATACACGTCTGCAGGTGGAACACCCTGTGACGGAGCTCATCTCACACG
TAGATCTCGTGGAGCAGATGATCCGTGTGGCTGCTGGACATGCACTACCAAAGGAATTGGTGGATGGACCTGTGAAGATCCATGGTTGGGCTATGGAGAG
TCGAGTGTACGCTGAGGACCCTCTGCGTGGCTTCCTACCATCTATCGGGAGACTTCTGCAGTACGATGAACCGGTTCATCTCCCAGGAGTGCGTGTGGAC
TCGGGTGTGAATGAAGGCAGTGACATCTCTATGTTTTATGACCCGATGATCTCGAAGCTTATTACGTATGGAAAGGACCGTCCGGAGTGTCTAGAGCGTA
TGAAGACAGCACTAGACAACTACGTGATCCGCGGGCCTGGAAACAACGTATCGTTCCTGCAGGATGTATACCGTCACCCTCGCTTCGTGAGCGGCAAAAT
CACCACGAAATTTATCGAGGAAGAGTACCCGGATGGCTTTGATGGTGTGAAGTTGACGTCTCCCGAGATTGAGGATCTCAGGGTTATCGGTGCGATCATG
CACCTGAAGAAAGCAAGTGCTAGCAGCCAGATCTCGGGCCGTATTCAGTCAACACCTGTAGAAGGCTTTGGTCCGCTCGATTCCCTCAACGAGGACGAAT
TGGAGTTTGTCTCTGACCAAGCAGGAGTTGTTCCACTTCTGCGTGCAATCGCCCCTGGTCTATCGTCTAAAGAGCTTATTGCCCTCGCGGAGCGCAACAA
CCTCAAGAACGTGGGCGCTCAACTGGCCGTGAGCATTGATGGTCCATTTGGGGTGTCGAACCCTGTTGTTGTCGTGGAGGTTGAGGTGGAGAACAAGCGG
CGCCGCATTGAAACGAAGACACTGGCTTTAGTAGACGACAAGTGGCACGTTGTGGGTGATGTAGACTGGTCGCTTAATGGTCCGCTGTTCAAGGCGTCGT
ACGCAAAGCAAAACGGGGCATCCGATGTGCCGTTGGCGTCGCAAATGTTGCAAAGTCTACCGGAGGGTTTCCGTCTTCAGTTCCATGGTGCTGTGCATGA
TGTGGTTGTGCGCAATGAGTTAGAAGCTGCATATGGCAAGCACATGCAGCCGAAACCCGAAGTTGACACTTCCAATTTGCTGCTGTGTCCGATGCCCGGC
ATGCTTGTTTCAGTTGCAGTGGAGGTCGGTCAACAAGTTGAGCTTGGCCAGGAGCTAGCTGTGGTGGAGGCCATGAAGATGCAGAACGTGCTTCGTTCCG
AGAAGAGGGGCGTTATCAAAAGCATTACGCGCGCTGCAGGTGACTCGCTCAAGGTCGATGAGATTATCCTCGAGTATGAATAAGCAT