Description :
From Genome Similarity Track
Location :
Scaffold_758:5198- 6681
Transcript NameFunction/comments
Phymu_g11860hypothetical protein PHYSODRAFT_516060

Sequence
1483 bases(100 bases per row)
AAAATCGCCTTCAACCTCTTTTGCTGCGCCTACGGCGTCGGAACTCTCGGAATGCCCGGAAATTTTTCCAGAGCAGGCCCAGTGATCGCCATCTTTGCGT
TAATTTTCATGGCGTTCGCCAACGTGTACGCGTCCGTGGTAATATCaaaggtgctgctgctggcaccAAGATCTGTACGCACGTATGGCGATCTTGGCGA
ATGGTGCATGGGCAAAGGCGGTCGATACATGGTTGTTGTCTCTCAAATGGGTGTGTGTCTACTCGTGCCCTGCGTGTTCCTCGTGCTGGGGGGCTCGCTA
CTCGACGGGCTCTTCTCCGATGCATTCGACCAAAAGGTCTGGATTGTAATTATGGCGCTCATGGTACTCCCAGTTTGTCTTATCCCAACGCTcaaggaag
gagctggcgctgccTTTGCAGGTTGTGCTGGTACTATAATTGCTGATTGTATTGGTGTTGCAGTTGTCGTTCATGGGATGCGTGGCCATCCCAGCGTTCC
TGCCCCTCAAATCTCCTTCTCGCAAGTTGCCAGTGCGTTCGGCAACCTGTCACTCGCCTACGGCGCAGGAATTGTAATCCCGTcactccagcgccaacac
aGCGACCCCACTCGAATGCCCCGTGTAGTTGCCGTGACTCTGACTATCGTCTCGGTCCTCTTCCTCGCACTGGCAAGCAGCGGATACTCCTCGATGGGGT
GTCAGATATCAGCAACCTGCTCTTCACCATCTACCCAGACGCTGTCACGGGACTGACTTCGCTCGGTTTTGCCTCCAACTGGGGCGCAGTCGTCCTCTCA
TACCTCTTCATGCAGTTGCATGTCACCATTGCTTTTGCTGTCGTGGTATCACCAGCATTTTACATCGCCGAACGTCTCGTGCTCGGAATGCACCAGGACA
ACTCGCAGCAACACCTACCGAGGGATGATGACATCCACATTGTGGAGGCGGTAATTAGCTACGACCCCACCGGAACTCCTATCTTGAAGGGGCAGCGAAG
TTCAAAGCGATCCATGGCTTCTGTTGTCTCTATGGCAGATATCGAGAGGGatgtggacgaagaagccgaagccgctGAATACCGTGGGGCCAACTTGATC
AAGTACGTGTTGCTGCGAATTGCCATTGTTGCGCTCCAAGTTCTTGCGTCGGTACTGCTAAAGGATCACTTCTCGGACCTTAGCGACTTCGTGGGCTCGT
CAGCGATAACCATGAGCTGCATCATCTTGCCCATTGTGTTTTACCTGAAACGCTGCTGGGATCGAGTTCCTATCTACGATAAGGTGCCTGCGCTTCTCGT
GGTCGTCGTCTGCTTTGTTTTAGGCTGCTACGTGACGTATCTGTCCGGCAAGGAGCTTTTTGCGCCGTCTGAGAGCGATGTCAACTTCCCGTTTTGCGCA
CCTGAGTACCAGGATGAAGTTTATTACAACTACACAGCTGAACACGAGGCGTAAGCTCGGTAGTGGGAAGCGGGCCGAACCAC