Description :
From Genome Similarity Track
Location :
contig_149:51979- 53037
Transcript NameFunction/comments
g14354.t1hypothetical protein

Sequence
1058 bases(100 bases per row)
TCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAGGTGTGTGTCCTGTCGAGACATG
CACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCCGGTCCATTGATGGAACGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGA
CACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACGGACAACTGCATCCCAAGAAGTGTAAAACACTTCTTGCCAGAATCGCGCTGTAAAG
CGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAAACATGCCGTCTGTTTGGCTGTCACCTCGGCTG
GTACTGCAGCAAGATGGTACATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCAT
TGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGA
ACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCA
TCGTGGTACTCATACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCAT
TGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGC
ATCCGCATCATGCGCGTATGCGGCTTCACGTCGTCCAACAAGGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGAACCGCATAATCGGGTCGACGCGAA
AGCGCGTCGGCCACGACATTCAACCTTCAGGTTTGTACTCAACCTGGAAGTTGTATTC