Description :
From Genome Similarity Track
Location :
contig_147:51978- 55055
Sequence
3077 bases(100 bases per row)
AAACCAAAGAATTCACGCACTGCAATATGTTTTCCGAACACTACGGCGAGCAGGTCTCCTGTTCTTGGAAGACGATGTGGCTGATCGTCATGTTTTGCTG
AGCTTCGAGGCAGCGTTGAAGCCAGCGCTTCTCCAGCTACTAGAAGGTGAGTTAGAGAGCACGACAGTTGAACGACCGACTAATTGTGCTGTTGCTCTTG
CCCAGGTCGCTTGCAAAGTCGATCTATTGCTGAACTTGCAGATGCAGTACTGGCCCAGGAGCGGTTTAAGTGTATCCCTTTGCAGTGGATTGAGACTGGC
CTCGAGAAGCTTCTGATGACTCATTTAGTAGCTCAAAGAGAGGAAACGCAATTATTTTGTATCAACGACGAGTAAATGCAGCTCGACTACGGACGGAACT
CTTCACGTAGTAGCCGCCTCCAAGTAGTAGACCCACGGTGGAAGATCCTTCAGCTGAGGACACGACACGAAGAGTTTGCCTGTCTCGCTGACTCCACTTT
GTGCCTTTTCACCTCTTGCTGACGTTGTGGTATTGTCTACCTTCACCGTGATTGTTTTAGATGACTTGGCAGGTATTGACAGCGACGTTGTCGATAGGAC
AAACCGAGGGTTGTCCACCATGACTCGAAGTCTTTCGCCGTCGAGAATACGTTTTTAAACTCGATGTCTTTAGATGTCGAGAAGACGTAGGGGCCTTGAG
GCAGCGGCGGCACAGACACCCCTTGAAGGGTACATTTGTACTCGCCGACACTGTTTGAAAAGAGTGTAAGTGTATCTCGGAACTCGCCGATCGCTTCGGG
TTCGAACTTGGTAACGATTGATTCAGGTTTCCCTTCCCATGAAGATGACCCTCAACCTTGCACGTTCCGGCCACGGTAAATGACGTCGGATCTTGGACGG
AGCACGATAGTTCTGCTGCAGCGTTAGCGTAGCATGTGAACGTGAAGGTCTTAGCTTGAGAGCCACCCAAGGATGTCTTGAAGTACAAGATGCGTTCAGG
ACCGACAGGTTGAGTACTTTGCACCAGATTGTACGTGTACTCGCCGAGCTCCACAAAGCTAATGGTTAGTCGATCTTCGACGGGTGTCTCGGAGTGCAGT
GTGGGTCGGTACTCAATCTCATAGGATCCCTCCGATCGTCCACTGATCTCGTTTAGTTGACGCACACGGATAGAAGGGCTGGAGCACTTCCACCAGTTAA
CTTTGTCCACAAAATTGATCTGGCGCTGGGGGTCGAACGGGTTTTCGATGGCCACCGTCTTCTTAACTGATTGCCGCACAGGAGCCTCGAAGTATAACGT
GTCCACGTCAACAGCCTTTGAAACAGCCACCTGAACGTCGTGTGCAAGGTACTCACCACTCTCCTGGTTCACCAATCGGACACTTAAACCCACCGTTCCT
TCCGTGTAGCAGAAGAACTTCATCTTGTAGCTGCGCGATGCACTCGCGTGCAGTAGAATCGACGACGGCCCTTGTACGACGACGGACTCATTTCCTGGTG
GCTTCTGGATATCGACAGCAAACGATTGGGCTGTCTTGAGCCAGTTCCTGATCGGAATCGACATTGACAAGGTCTTCTTCGCAGCAGTAGAGAGCGAGAT
TGCAGCAGCAGGTAGTGGAGCTGATGCCTTGCCAAATACATTGTACAGCAACGCACTCCCGTCAGGTATAGCGAGGAAAACGGATCCTTTGTGGACCGCG
GGGCGTTGCGAGTCGATTTCTTCCTGGGAGTTTTGCTTCGTCATGACCAACGGAGAGTACAGCACGTCGAGGTTAGCCTTGCCATGGGCTGGAACTAGAA
CGTTCTCTGGGCACGACCAGTGATCGCCTTGCACAACCGGGAACAGGTTCCACGGAGAAGCAGTCGTGTTCTCAAGCACAATTGCTTTGTGGGTCTCCTG
TCGAACCGGAGAATCGAAATTGACGTCTTGGATGGACGATGTCGCCTGCGGAACACACGACCCCACCAGTGTCAATGTAGCGGGAGCAGTTCCCTCGATC
ATGCACGTAACTCGATCGTAGCGAATGTCTGGATTCACGGCGGCTGGTTTGAAGGCCACCTCGATTATTTTGTGCTGGTTTGGTGCCACAATACCTTCCG
AAGGGAAATCAAGAAGTCTGGAGCAAAGTCGCGGACGTTCCATTGAAACTTGGTGGGAATGTCTCCGCGATTTTGTAAGCGTATTTTTCTCACGAGCTGA
CTGCCCAAGCACACTGCTCCATAGGAAAGGGTGTCAGTCTCCAACACCACCTCAATACCTTGACAACATCCCGACAATACCAGCAGTTTCTTTGTGCTTC
CCCAACACGGATAAGTACCTCTTTCTGAAAGCTTGGGATTCGTTGTGTCGGCGCAAAGCGGAACTCGAGGTCTGCACTCTCCTTGGCTCGAAGCGAGATT
TCGTGCCGAACCGAGATACCAACGCATCGAGCGATGCGACGCCTTGTTGCAGCGAGTCCACACATTCCACCACTGTCTTCCGCTTCGAGCGGTTTGCGAT
CTTGACTGTCCGAGAGGTTTGCTGGCCTATCTGCAAATTTCCGAGGACAACCATCTGCATGGATGAGTTCACTAGCTCCACTTTAGGGAACACGCCTTCT
CCACGGACGCTAATGTTTATAGTAGACGAACCGTTGACGGTGAACGGAACTACATCAAGATACGCAACTTCGTGCCGGGCGGTAAACACGATCGGGATAT
TAACCGTCTCTCGTGGGCCAAGCACAGTAGGAGGGCAATCTACACGTAGGTGGGGCTTCTTTTCAAACAAACAATCGAGATCAATTCCACTTTCAGGATC
CATGTTGAACACTGTAAGTGTAGCTGTTTCTGCCATAGGAGCGGAGTCGTTTCTGCGATGAAGCACGGACCAAAGTCGTGGGACGTAAACGAGAATTGCA
GCATCGAGGAACTGCGTTGCCTTGTAGTGCTACCACATAATTGCGGGAGCCTGCAACGGTACAGATCGCTTGCATTCCATCAAGGGAATGCTTGCTTTGT
TGGAGCGAAAATTAGCTTGCATGTAGTCTTGTCGTTCTTTTTGATCGTGCCTTGCGTCGGCTCAATAGAGAAGGCTG