Description :
From Genome Similarity Track
Location :
contig_76:51967- 54721
Transcript NameFunction/comments
g11854.t1hypothetical protein

Sequence
2754 bases(100 bases per row)
ATCAGTCGATATGAGTAGGTGTGGGTTCTCTCCTGATATGCTGCGATAGTATGTTGTTCCGGCCCCGTTGGGGGCTCCAGCGCGTCAATCAGCCCCCATT
TTGTCATGAGCGCCTCCAGTGCCCAGGAACCATGATCCGAGTGCGGACGGAAATGACTTCGGTCCACGCGGGGATCAAGCGTACAGTTAAAAAAAAACGA
CAACCACCCGGTCCAGCGATGGCAGTTCCATCTCCCCGAGCATCCCATAGAAATCCTTTCTCGGGCCTTTTCGGTGGGGTATGTAAATCCAAACGAGCAG
CATCTCCATGCCGTCAAACTTCCCACTCACTGCCATGAAATGAGGAGACCACCTCTTCGGCTTGACCGATGTCGCCTCTTTGAGAAGTCCGTATGGATCC
ACCAAAATGGCCACGCCGCCCTTCTTCTCTTCCGACGGTGCCCAAAAGCAGAGCGGTGGGCATCCCGCCCCACCCTAAAGCCCCACGTCGAAGCATGTAG
TCGCGTAAAATATTCCACGTTGCCCTGCTCAACATGTGTCTCCTGCAATAAAACAACGTCATATCTGCCATGGCCGTCCGATTTCTTCCAGGCGCGCATC
CATTCGTCCCAGTAAGCGTCATCGGCCCCAAACCCATTCACATTTTGCGAGAGGCAGCTGTAGGTGCGTTCATCAGGGTGCAAGTGCCGCCTCCTCTGCT
CCGGCTGTTGATCCGCTATCGCTTCCGCCCGCTTGTGCCGCTTTGCCGCAATTCGTTTGGCAGCTGTGAAAACTCCTAGTACCTGGTGTTTACGCTCGTC
CGCTGCAATATGCGAGAATAAATCGCCTAGAAGGGGGGTATTGCCGACACGCCCGCCGCGTGGAGAGCCTCGCTGCCCCCCCCCCCCCCCCCCTGGTTTG
GTCCATCCGGAGTGTAATTCGAAATTCGAATGGTCCACGTTAGAGGCCTGGCGGCCCCACCTCCATTGAGATGAGTCTGTCGTCCCACGTGAGCCCGCTC
GGTATCATTACCGCCGCTCCCCATCCCGCTCGTTCATCCACCATTTCACACAGTGCTCGAATCGCCGGATGATTGTAATACTGATGCCCGAGCTGACTCC
TTGGGACTCGACCCATGGCCGTCGCTGGCCACGCCCACAGAGTGTGCGGCAGTGTGTGGAGAATGTTCCAGCAGGATTTCGTCATGGATTCCGGTCTCAC
ACAGATAGGTGCGCGAGGGCATAGTTGTCGATGTTTCCCCCACCGATGACGATCGCTGCCCACATATATGTCTTGCTCGTCCCCGTCGTGTAATGTGCAA
GCTGCCAACCAACTGCGCCAGTGCTCAGCAGATTCAGCGCTCGAGGACGTGTCTCGCATGACAGCTCTGATCGCCGCCACCATGACGTCTTACGCCTCCA
GTGCTCCCCATTGTTGCAGTACTTTTGCCGGCAGTTGCTTGCCGCCAATTATAGATATGGTCGGTACTCAAAAAGGCTCCTGAGCTCCACGCGATGCGAT
AGCAACCACGGCATCATGTCCACAAGCCCACGGCTGTCATCCTTAGCTTTGGTCAGCTCTTTTGACTGGGGGGAAGATCGACTCCACACCGCTGTCGCAT
CCGCATTCACCTGCATTAATTGTCGGGATTTCGTGCCATCTGGAAGGAGTTCAGGCTCTAGCCCTATCGAATCCAAGATCTGTTGTAAGGGAGCCACCAC
GACCCTGCCATGCGACGTAATTGGAAAACGCGCCGATGCTCCGCCACATTCGGGTGTCAGCTCCCTGGGCTAGTCCTGGTGCTGTGTCACCATCGGGACC
AGCCGCAAGCCGCAGCCTTTCCCCTCTCCAACGAGTGTATCCTCCATTCTCGCTATATCGTAGCCAACGCTGTTAGCCTCGGGAGTCCAAGCCGGTAATG
TAGCACATCCAGTCGGTTCCTGTGTTCGATCCCTCCAATGAGAATCATATCATTCTCTTACGTGATCATCTTCGGGTCCACCGCGTGGATCCGACCAGCG
CTGTAATCGATGTGGGCGACGACGTTCGCATGCCAGGCGTGGCTGGAGCAGTTGGCGTCCGCAAACTCTCGGTCCTCTTCCGCCAGCCACCTAGTCGATA
TCTCCCTGTGATGTACGCCATAGAAATGGCCCTCATGCCGTTTGATTACTAGCATGACCGGTAGGATATGTAGTCTCGTGTAGTGCTTCAGCATGTCCTT
GGCCGTCAAATCATACATGACACCTCCACAGCCCGATTCATGGTCACCTCCGTAGGCCAGCGAGTAGTTCTTATAGTAGTAGCGTTGGACATGGGCGTCG
TTCTTGGCATCCCACATCAAATACGAATAGCGGCTCACGGAGATACTGGGCCATGGCCCTCAGCACTTCTGTCCCCGCCCAGAACTCGGAGGGGATATGG
GTATTAACCGACCGAGCCGTTCCTGGCGTAATGGGCAAACAGCGATGTCGTTGCCGCGACCTGATCCGATGACGGCGGGTGCTCGGGATACAGTCGTGCG
AGCTTCCTCGTCGGGTCGACGATTCCGCACTCCACATCACGCGCCAAGTTCGTCATCATCAAAGTGTAGATACTTCGCTTGATGGCGTTGGTGTGGCGTA
CTGCTTCACTCGTGAATGAGAGAGAGAGAGCCGCCATCCACGTAGGGGTGGCATACAGCGGCGCATAGTCACATTGCCCATTGGCCGGCACTGTCACCAG
CGATTTGTTGAACGGCCCCAGGAACGCCGGTCATTGCTGCGGCATCCCACTAGG