Description :
From Genome Similarity Track
Location :
Scaffold_1:5195470- 5198161
Sequence
2691 bases(100 bases per row)
ACAGTGTCGGATTAGCATTAGCTTCACCAAGAGCATCTTTTGCCAACCCAAGGTGGACTTTCTGTCGCATAAAATTTCGCCAGAAGGTATCAGAGCTGAC
CCCAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACGAGCAAGAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATTC
AAGACTTCGCGGTCTACGGTGCGGCGCTGTACCAGCTCAAGGATGAAGACTTTGTCGTTCCTTCGAAAGATTGAAGACGAGTGTTTCACATTCACCCATC
CTCAGGCACTTCGATCGGTCGAAAGAAGTTCACGTCATGCTCTTTGCGAATGGATGGGCGTTGAGCACTACGCTAATGCAAGAACATGAAGGCAAGTTAC
ACCCCGTACGGTTCCTCGGTCGGGTGCTCAAGGAGGCTGAGATGAACTACCATCCTGCTGAGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTG
TTACGTCCAGCTGGCAGGAAAGACGCTACATGTCGATACACGATTCTCGACGTTAGAGTGGGTGCATAAGTCGAAGTCTCTCTTCGGACGCGCGGTCCAG
TTCGCAGTGCTGCTATTGCAGTGGCACCTTAAGGTGCAGCGCGTGAAAGAGAAGGATGTCGCCTTTGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCG
TTGACCTGGAGGACTCGCTCGCGCCGGTGGCACCTCCAAACAAGGGTTCCCCGACGGTTCGAATGGACCCCGCGTTGCTGTACGCCAGGCTTTCCCGTAA
TTACAGCGGATTCGTCATGTCTTTTGACGGATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGG
AAGGTAGTGATTGCTGCAAACGCTTACCTCTCGGCCACCACGGTGAATGAGGCAGAGTACACAGGTATGATAAACGGTGTCAAGGCTGCTATTGCGCACG
GTGCCGAGGATTTAGTCATCGTTGGGGACTCAAGGCTCGCGATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGCTGAA
TACTCACAAGGAACTCACGGCAAAGCTTCGATCAGTTAAATATCTTCACGTTGTACGAGAATACAACGCGGCCGCGGATTCGTTAGCCACTGAAGCGCTG
GAATCGAGGGTCAGTCGGGTAATCTTGGCTGAAACTCGCAAGTCCGAATTGGCATCGCTGAACCGCATCCAGGAAATGATCTACGAGCCGGATGAAGACT
CGGTAGATGTTTCGTCACGAGGAGCAGAGCGTCAAGTACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAAAATTTCGTGGTTGATTA
CAGCTCACCAAAGTGCGATTATGGTAATATAGCAGTGATGACTCGGCGACAGACGAAAGCCAAGAAACGCGTCAGGTTTGCAGATGAACACTCGGAGGAT
GTCTCAAAAGCACAAGAACAGAATGAAGAACGACGAGAGACGTCCACCGAAGATTCATTCGGCGAAGATTTGCCAGACCATCCTCACAAGACTGTACCAG
CGGCATTTCCCATTGCGGAAGATGTTGACCCAGTAGCGATACAGCGGGAACGACGCAGACGGATACTGGTGGCACAAGACGAGGAGCAGAAGTGGTTTAA
CATCAAGAAGGTGCTTCAGGGCCAAGCACAAGAGCTGAGTTACAAAGAAGCTCGAAATGCTTGGAAATACGCTGACCGGTTCGTGTTATCAGAAGACGGC
GTGCTTCACTATCTTGGATTTAATCGTCGATACGACCACGGTTGGCAAGAGGAGACCAAGCTGCGGCTTGTGGTACCGACAACGATGATTCAAGAGGTCT
TGCAGAACTGTCACGACTCGCTGGAAGGAGGACATCAAGGTGTGGTGAGAACGTTCCATCGCGCTAAGTCCGATTATTATTGGATCGGCTTGTACGCTGA
CGTGGAGAAGCATGTGAGGTCATGTCCAGATTGCAGCTTGAGTAAAAGCCGTCCGCAGCTTCGTGGATACTCACCTGGCAACGTACTAGCCGAACGACCT
TTCCAGATCGTCTCGATGGATTTTGTGTTACCACTACCGAAATCTCGCAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTCGTTCACGGGCTTCGTTA
TTGCCAAGGCTATGTCAGATACGACTGCACTGAGTGTTGCCCAAGTGTTCGAAGAATGTGTGTACCGACGGTTCGGAGCCCCATCATTAATACGGCATGA
CCGCGACCCACGCTTCATGAGCGAGGTGTTCCAAGCGTTCGCAGAGATGATGCAGTCAAGATCAAGAGCGACTTTGAGCTATAGGCCACAGGCTAATGGA
CAGCAGGAACGCTCGGTGAAGTCAGTGATGGGGTCCGTACGGGTGTACGCGGAAGACCCTCTACAGCAAGATTGGGACGAAATCGCGGAGAAGCTAGTAT
TTGCTATTAATACTTCTCAAGACACTACGAGAAAGGAAACGCCGTTTTACCTCGTTCATGGTTGGGATGCGCAGTCGACGTTGCGGGCAATGTCGTCATC
ACTCAAACGAGGACTCGGCAAGCAGTCTGACGCACTGGCGTGGCGGCGCGAGATCAATCGACAACATGAGGTCGCCCTCACTATGGCCAAA