Description :
From Genome Similarity Track
Location :
Scaffold_30:51942- 53846
Transcript NameFunction/comments
Hyaar_Emoy280459360S ribosomal protein L15-1
Hyaar_Emoy2804594enoyl-CoA hydratase

Sequence
1904 bases(100 bases per row)
AACGGTAGCGACGCAGCGACAGCGTGTTGCGACGCTTCCAGTTCTGGCGGAACGAGGAACCAATGATCTTGTTGGCGCGGTGACCGCGTTTGCGCAGGCC
ACGGCCTTGGCGACCGGCCGACGTAAGCCCACGCTGCTGGCGTCCCTTGTGCACTGCGTTGACGATCCAGTTGATACGCGGGTCACGACGAATGACCTTG
TGCGAGTGATCCACCATGATGATCTCAAAGTACTTGTACGTCGCGTCCTGGTTCACCCAGTACGAGTTGAGCACACGCAAGTTCGTGAACTTGTTGCCCG
CACGCTCTTCAGCCACCGAGCGCAGGTTGCGTTCGAACTTGAGCTCGTTAATACCGTGGTGCTTGGGCTTACCGTAGACAATACCCTTGGAGTTCGGGCG
CTTACGGCCACCACGACGCACAGCCACACGTACGATCACATAGCCCTGCTTAGCTTTGTAGCCAAGACGACGAGCCTTGTCCACGCGGGTGGGGCCGTTC
ACACGGTGGATCACCGGCAACTGACGGTACTCCCACGCACGCACACGAAGCAAAAAGCGCAGCACATCCGACTGTTTGCGCTTCCACAGCTCTTCCAAGT
ACTTGTAAGCTCCCATCCCGATGCGATTTTGCTAAATGATTAACGATTTTCGGCGATCAGCAGCCGCCAGCCAGTCGTTGGATCAAAGCTGCTTCACGCA
ACATTAGAGTAAACCCGGTATGACAGTACACGGTATACCAGCCCGTGAAACGGTACTTCAAATCACCACAATCGGTATATATACTAGTACACCGTAGCGA
AGCATCACCGGTGTATACCTATCTGCGTATTTGCAGTTGGGCTCATTTCGATTTCTGATATCAGATGCTGACTGCCCTTACGTGCACGCCGATAGGTAGA
CGACTGTCCCGTTGTGTGCTGCAGCTACGCAGGCTACATGCAGTTGCCAAGACGGAGCAGTTCCACGTGGGAATGCTAGACGGTAACAATACGGGAATTG
CGGTCTTCACGATGGACCGCCCGGACGCACGCAATGCCTTAGGTCGCCAGTTTATGGCCGAGTTCCGCCAAGCACTCGAGCAAGTCCGCTTTGATTCGAC
CGTCCGCGTGGTGGTTGTTCGTAGTGCTGTTCCCAGAGTATTTTGTGCGGGTGCAGATCTGAAAGAGCGTCTGAAGATGACGCCCTCCGAGGTGACTTTG
GTTCGCGGTGTTGGATATCCAAGCGGATGTATACTTAACCAGATATGTGTTGCGTATGTTTTAATATGTAGGCTGCTGCAAGTTCCCGTGGCTACCGCAC
CGGGTTCACGGATCTAGAGCAACTTCCTATGCCGACCATTGCTGCTATTGAAGGAGCTGCTCTTGGTGGAGGGATGGAGATGGCACTGGCGTGCGACCTC
CGCATTGCTGGAGCCAAGGCAGTACTTGGATTCCCAGAGACGTCCCTGGCAATTCTTCCCGGAGCTGGTGGAACCCAGCGTGCAGCTCGCTTGATTGGTA
AGGTGGATGCCGTGCTATGAACAATCAAGAGCTGAATGGTCGTACTCACGTCTTCTTTTCTTGTCCTTGATGCCGCATAGGGATCTCCAAAGCCAAAGAA
CTCATCTTTACCAGCCGTCGTCTGACTTCTGAAGCTGCTGAGAAGATTGGACTGGTCGATTATGCCGTGCCTGAAGACAAGGCATATGACAAAGCGCTGA
AGATTGCTCGTGAGATTCTGCCCAATGGACCTGTTGGCGTCCGCATGGCAAAAGAAGCAATCATGAAGGGCTCTGAAGTGGACATTGCTACTGGATTAGC
CATTGAGAACGCTTGCTATGCACAGGTGATCCCGACGAAAGACCGCATTGAAGGTCTGACAGCGTTTAAGGAGAAACGCAAACCGCAGTATACCGGCGAG
TAAA