Description :
From Genome Similarity Track
Location :
Scaffold_1739:5194- 7296
Sequence
2102 bases(100 bases per row)
TACGCGTAACATGAATGATTATCAGCTTAAATTTGAAGTGTCGCCGACTCCACGTAGAATTCCTGCATCATGCTCGTATCCAGATCACACAAGTCCACCA
GGTTCCTCACTTCCGTGTTCGTCGTTCAACGATGCCAGGGGCGTTTTGGCTTGTttggcttcgtcttcttcatctctcACTTCCCCACTGTAGGTGTTGG
ACGTGAACGTTGTTGAGGGTTGTTTGCATTGCGGACAGCAGCCGTGTTTACCTTTGTTCAGCAGGAtccgagaagaagtcgccacAGATCTCTAAGTAAT
GCGTACAATCGAGCAACATGACTCAGATTGAGCCGGATTGAGCCGGAATAAGCGCAACATCCTTGATTGCGCAAATATTCTGTCACACGACAGGATCTCT
ACAAACAACGAAATTTTTGAAATTTATTTGCGTAATTTATTCGCGTAGTGTGCCATTTGTGCCTTGTGTGCCTTTGTATAGTTCTTATTATGAGGGTGAC
TCTAATATGCACTTAAGTACGAAGGCACACAACCATTGTGTGACTCTAACATCGATCAAATGAAAATCCTGCGTGTATCGTACCTCATACGAAAGGGGAA
ATTCGCGCCAATCTAATCATTCAaactatccaatcaaaacgtTGGTTTTGGACACGTCATCCTCGATACAAAATACCGGTAGTCTCATGGAATAGGGTTG
GCTCGACCAAAAAATCCGTTACGACCAGAAATACATCACAAACGGATACCCTCAATCTGGCGACGTGCACTAACAATTGGACAAATAAACCATGGAAAGT
GActacagttgtgcacctcgttttcggcagggtggaccaaatcaaacatcacaggtgattgGATATTCGAAGTGCGATTGACGTAAAAAACCATCGTGAG
GTATATAATATTCAGGGGTATGAGTTTATATAGGTGCCGAAAACGATTGTATTGACACAAGATGACTTTCTCGCCTTTTGTATATTAGCCCGTTTTGGCC
CTTTTTTAACGAAAATGCCAGGTGGAGGTGAAAGCCAACTCGCTCGGCAGACCGAAACAATGCCTGCGGTTTAAGGTCTGTGTGCGTAGTAcgcgggctt
aaacccaggactaagcatggtcaccttctacttGATCgtatagggttaagcccttccAGTAAGGGTTTTGGGGGGTATGATTTAAGTTGGGTAACAGAAT
TCATttcgacacctccaattttgTAATTTGACGGTtcgtgacatccgtcctccagcttgtgTCAGTATTCTCTGCCTTCATCGATGCTACATATATTGCT
TGACAATCCATTCacagatctgcttcttctgcgcgaaGGTGAGGTGCCCCATTTGCTTAGGTCGCTTCCTCATTGCGAAAACGTTAATGCCAGCGAAGTT
GGGGGCCTGTCTTCGCTGGGTTTGTGGCAAATTCTAAAACCTGATGATCCTCATATATATGATAAGTTTGTTGTCCACCTGATAAAGTGGCAAGCCTTGG
AAGTGCGATGATGTGGGCCATCGCAACTAAAATTGCCAACTGCGCTCTAGAAGCCGGACAGACATCTGAAGGTGGTACATACAGCATGGCGCGACAACGG
GTCCCAAAACTGCGggtgctgctcgagcaaAACCTGAGCAGGAACCTCTGCACGGTGTAATGTGCGTAGAGTGCCTATTGCAAACGAGGGAGAGTCGGAC
TCCCCCAAGAACCGGCACTGGTAAACAACCACTTTCTCAGTGAGAAGTTCTCAGGTTTCTATCGTCGGGTGCTGTAAACCGACTGGAACTGACGAACGGG
CAAGCGAACGACGTTGTTCACCCGAGTTGTTGTCCGATTATTTTGTCAACAAAGCTAATCATGTAGCTATTGGACGTGTGGTGCAGGAGCATTACATACC
TAGCAGGTGGTGCACACGGTACTGAATAGCGGCATGTGGTCGTCAGTCTGTACGTTTGCGCAGAACAAATGTACATTATTGTACTTTGCAATGCGTTTGT
CCGTTTCACTTATCGTtttgctcgatttataatCTTTGGAGCGCGTTATAAAAGCAGATGGCAAAAAAGAAAGTGCAATTCGACCAAGTTACTTATCACA
AT