Description :
From Genome Similarity Track
Location :
Scaffold_86:51939- 52990
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_86-fgenesh-gene-0.20Sporangia induced Bardet-Biedl syndrome 4 protein

Sequence
1051 bases(100 bases per row)
CACACTTGTTGAGGGCCAAGGACTCGATCAAGTGTCGAAATGCAAATTCGCTCTCTGACTCGGTCGAAGCCAAGGGCTCGGTATCAATGCTGCACGCAGA
GGCAAAGCCATCAGATACACCTTTCCTCGGCTATTTCATGTGAGCTCTGCATCCGTACACGATCTGATCCACACGCGTGGCCTCAAAATGGTCCAAAACG
CGCTTGGCGACGTCGTCATGGTCGTAAAAAAAGCGCGTACAAGCGTCACGCCACAGCGCTAGACGCGTCTCTTGACGCGCCAGCAACGCTTCGCATGCGC
ATTCTCCTGTAGAACCACCTTAGACGCCTGTGGACGCGTGTATAACCAGAGAGACGCCATCAACTCACCTCCCATGATGCTTCCTGGACACTGCCCACGA
TTGATGCAGTATCTCCGATTATTGTCCAATCATTGAAGACGGATAGTGTTCGTTAGATATGGTTTCATCGTTATTTACGGATCATGCCGTTTACGGCTAA
TCAATCAATACGTTGAGAAGCGCTTGACGCTGCTCAAGCACTTCAGCATCGGCAGAGCGCGTTTCTTCATCAAGGGCCTCGAAGATCTCCTCAAAACGaT
CGAATTGGATCTTAGCACGCTCCATTTCGtCGTTGTTGTACAGTGTAATGGCGTAATTCAGGTGGAACATGTGATCTCTACCATGGCCCGAAGACAAATA
ATTaGAAAaCCTGGTAGCTCGCTTGACAAGATTCATGTACACTACTCACCGTTCCATCTCAATAGCCTTTTCGAAGGCACTACACGCGTTCTCAAAGTCA
TCGAGCCGCCCcAAAGTGATCGCGAGGTACATGTATGAGCTGGGGAAgTCGGGTTTCAGGTTGATGGCGGCACTAAAATAGTGGAACGCGGACGCGTATT
GGCCCGTGTTCAGGTGCACAAGTCCGAGGTTGTACGACGTGATCCACTCGAAAGGGTCCAGATACAGCGCCCGTTTCAAACATGCCACAGACGCAACGTA
GCGCTGCTTGCCGAAGAAGCACATGCCGATGTTATTCCACAGCTGTGCCGA