Description :
From Genome Similarity Track
Location :
contig_76:51931- 54685
Transcript NameFunction/comments
g12417.t1hypothetical protein

Sequence
2754 bases(100 bases per row)
ACCGATCCAGCCGTGCTGAGGCCATGTCCCCAAACATCAGTCGATATGAGTAGGTGTGGGTTCTCTCCTGATATGCTGCGATAGTATGTTGTTCCGGCCC
CGTTGGGGGCTCCAGCGCGTCAATCAGCCCCCATTTTGTCATGAGCGCCTCCAGTGCCCAGGAACCATGATCCGAGTGCGGACGGAAATGACTTCGGTCC
ACGCGGGGATCAAGCGTACAGTTAAAAAAAAACGACAACCACCCGGTCCAGCGATGGCAGTTCCATCTCCCCGAGCATCCCATAGAAATCCTTTCTCGGG
CCTTTTCGGTGGGGTATGTAAATCCAAACGAGCAGCATCTCCATGCCGTCAAACTTCCCACTCACTGCCATGAAATGAGGAGACCACCTCTTCGGCTTGA
CCGATGTCGCCTCTTTGAGAAGTCCGTATGGATCCACCAAAATGGCCACGCCGCCCTTCTTCTCTTCCGACGGTGCCCAAAAGCAGAGCGGTGGGCATCC
GCCCCCACCCTAAAGCCCCACGTCGAAGCATGTAGTCGCGTAAAATATTCCACGTTGCCCTGCTCAACATGTGTCTCCTGCAATAAAACAACGTCATATC
TGCCATGGCCGTCCGATTTCTTCCAGGCGCGCATCCATTCGTCCCAGTAAGCGTCATCGGCCCCAAACCCATTCACATTTTGCGAGAGGCAGCTGTAGGT
GCGTTCATCAGGGTGCAAGTGCCGCCTCCTCTGCTCCGGCTGTTGATCCGCTATCGCTTCCGCCCGCTTGTGCCGCTTTGCCGCAATTCGTTTGGCAGCT
GTGAAAACTCCTAGTACCTGGTGTTTACGCTCGTCCGCTGCAATATGCGAGAATAAATCGCCTAGAAGGGGGGTATTGCCGACACGCCCGCCGCGTGGAG
AGCCTCGCTGCCCCCCCCCCCCCCCCCCTGGTTTGGTCCATCCGGAGTGTAATTCGAAATTCGAATGGTCCACGTTAGAGGCCTGGCGGCCCCACCTCCA
TTGAGATGAGTCTGTCGTCCCACGTGAGCCCGCTCGGTATCATTACCGCCGCTCCCCATCCCGCTCGTTCATCCACCATTTCACACAGTGCTCGAATCGC
CGGATGATTGTAATACTGATGCCCGAGCTGACTCCTTGGGACTCGACCCATGGCCGTCGCTGGCCACGCCCACAGAGTGTGCGGCAGTGTGTGGAGAATG
TTCCAGCAGGATTTCGTCATGGATTCCGGTCTCACACAGATAGGTGCGCGAGGGCATAGTTGTCGATGTTTCCCCCACCGATGACGATCGCTGCCCACAT
ATATGTCTTGCTCGTCCCCGTCGTGTAATGTGCAAGCTGCCAACCAACTGCGGCAGTGCTCAGCAGATTCAGCGCTCGAGGACGTGTCTCGCATGACAGC
TCTGATCGCCGCCACCATGACGTCTTACGCCTCCAGTGCTCCCCATTGTTGCAGTACTTTTGCCGGCAGTTGCTTGCCGCCAATTATAGATATGGTCGGT
ACTCAAAAAGGCTCCTGAGCTCCACGCGATGCGATAGCAACCACGGCATCATGTCCACAAGCCCACGGCTGTCATCCTTAGCTTTGGTCAGCTCTTTTGA
CTGGGGGGAAGATCGACTCCACACCGCTGTCGCATCCGCATTCACCTGCATTAATTGTCGGGATTTCGTGCCATCTGGAAGGAGTTCAGGCTCTAGCCCT
ATCGAATCCAAGATCTGTTGTAAGGGAGCCACCACGACCCTGCCATGCGACGTAATTGGAAAACGCGCCGATGCTCCGCCACATTCGGGTGTCAGCTCCC
TGGGCTAGTCCTGGTGCTGTGTCACCATCGGGACCAGCCGCAAGCCGCAGCCTTTCCCCTCTCCAACGAGTGTATCCTCCATTCTCGCTATATCGTAGCC
AACGCTGTTAGCCTCGGGAGTCCAAGCCGGTAATGTAGCACATCCAGTCGGTTCCTGTGTTCGATCCCTCCAATGAGAATCATATCATTCTCTTACGTGA
TCATCTTCGGGTCCACCGCGTGGATCCGACCAGCGCTGTAATCGATGTGGGCGACGACGTTCGCATGCCAGGCGTGGCTGGAGCAGTTGGCGTCCGCAAA
CTCTCGGTCCTCTTCCGCCAGCCACCTAGTCGATATCTCCCTGTGATGTACGCCATAGAAATGGCCCTCATGCCGTTTGATTACTAGCATGACCGGTAGG
ATATGTAGTCTCGTGTAGTGCTTCAGCATGTCCTTGGCCGTCAAATCATACATGACACCTCCACAGCCCGATTCATGGTCACCTCCGTAGGCCAGCGAGT
AGTTCTTATAGTAGTAGCGTTGGACATGGGCGTCGTTCTTGGCATCCCACATCAAATACGAATAGCGGCTCACGGAGATACTGGGCCATGGCCCTCAGCA
CTTCTGTCCCCGCCCAGAACTCGGAGGGGATATGGGTATTAACCGACCGAGCCGTTCCTGGCGTAATGGGCAAACAGCGATGTCGTTGCCGCGACCTGAT
CCGATGACGGCGGGTGCTCGGGATACAGTCGTGCGAGCTTCCTCGTCGGGTCGACGATTCCGCACTCCACATCACGCGCCAAGTTCGTCATCATCAAAGT
GTAGATACTTCGCTTGATGGCGTTGGTGTGGCGTACTGCTTCACTCGTGAATGAGAGAGAGAGAGCCGCCATCCACGTAGGGGTGGCATACAGCGGCGCA
TAGTCACATTGCCCATTGGCCGGCACTGTCACCAGCGATTTGTTGAACGGCCCC