Description :
From Genome Similarity Track
Location :
scaffold_17:519238- 520810
Transcript NameFunction/comments
Plaha_PHALS_11152hypothetical protein L915_15736

Sequence
1572 bases(100 bases per row)
TTTATTCCATTCGTTGTTCCGAAATTCGTTCAAAACGACGAGAATCAGGACATTTGATGGATTTTGGTGGACCAATTTTGATTGATCCACGATAACTTCC
ACCTGCAAAACTATTTGATGAGCCAAGACGATGTTCTCGTGTACAAATATAATGACCAGGTAATCCATTTGATGGAATTAAATATCCAAAAGTAACCGTA
CGAAATGATCCATCACGTCTTGTTGGTAATCCAGAAATTGGAACAACAGGATCAATTTGAAAACTTTCATCATTTGAAATCAATCGAATTTCTAAATTGA
ACATACTTGCAGCAGCATATAATTCCGTAATTGTTGCTTGTTCATCACATGTATCTCGAAAGGTTTCGAATCGTTCACGTACTTCCTTTTCATCTTGTAA
AAGAAACTGTGCCAATTCTTTGGAATAATTTAAGGCATAATTCATTAATTGTTGACGTAAATATTGTGCGGCTGCAATTCGTCGTGGTGCCATTCCATCA
ACTGCACCAACATTAACAATTGTCATATTTGCTGGATAATCTTGTAGACATTGTAACGGATACATTTCATAAACCAAACAATGTAATAAACAGGATCCAT
CGGGTGGCATTCCAACACCTACAAGACCCAATTGAAGTAAACGATCTTCCATTTTAGCACGTTGTAGATCAAGTTTTGGATCAATTGATGAAGTATTTCC
TACTTTTAAAGAAGCTGAAAACCAACTTCCTCGATTTGATCCAATCATTGAATCACGTGGTACAGTCAAAGATGTACGTACAACACTTTGTGGTACACTT
TGTCGTACAAAATGTTGAGTTCCTAAAAAACCGGTTCCCGACCAACGATATTCACTAACATTTGATGTAAATGATGAAACAGTTGAAAGACTTGAAACGG
AACGAaaatcatcatcttcatcacttAAAACACTTGATGtagtttgtacaattgttgGTGATGCTAAAATGGAGGATGAAGGTCGAAGATGAACATGTTG
TTGTTCATATTCAGCATTTGAACCAAATCCCGAATGAAAAGCCACAAATGTTTTTAACGTTTGACTACTTACTGCTGTCATATGAAATGCTACTAATTGT
GCTTTTGATGTAATCACATGCATATATGTATCCAATTCTTGAGTTCGAGATTCGAGAAATTCACGACTTTGAACAATTCGAAATAATGTACGACGACGAT
AACGTGGTGGAAATTTCACACCTTTAAGTAAGGAAGATGTACGTTTACGTAATTGATCGTCCAATTTAcgaaatgctgaaaatgtACGCCAAATGTGCCA
ACTTGTACGACCAGTAGTATGAACACGTGAGGAATAGAAAGAAAGTTGGACGACCACTTGATACTCGACTTTTTTACCATTATAACGATAATCTTTCACT
TGAATCTTACATGTATAATCACCTTGAATATCATCAGGTGTCATGATCATGAAGACGAGAAGAAAAGGATGGAGGAATGAGAGAAAGAGGGGGGAAGACC
AAAGCTGTACGCACAGGAACTGACTGACTCGACGTTTCTATTTTTCGAGCTTACGATCGAAAAATAGAATTT