Description :
From Genome Similarity Track
Location :
Scaffold_186:51912- 53122
Transcript NameFunction/comments
Phyta_totarag5278hypothetical protein PHYSODRAFT_246404

Sequence
1210 bases(100 bases per row)
tttcttcttgtgtttcttcttcttctccttcttgtcctcctcctcctccgcggccttcttcttcttgtgcttcttctccttcttctccttcttttccttc
ttcaccttgggctcctcctcctcttcggcGTCCTCAGCCTTACGCTTCTTGCTCGACACCGTCATGTCGGCATCGGCGTTGTACGACTTGctcgtctccg
tcttcgtgtacttcttcgtctcgttcttggtcttgccgttgctgttCGGAACGCCCGAGAAGCCGTTCTCCAGCTGCCGCACGCGAGCCTCCACCTTGGC
GCGGTTGTCGAAGCCAATGGTGGCCTCCGTGGCGTCACCCAGAGCGTCCACACGCACAGCCAGTGACGTCTTGGCGGCCAGCACACGCGAGATCTTACCC
TTGTGCTTAGGGGCAGTCTGGCCGATCAGAGAAGCGTGGTAGATCAGACCATACTTAGGGGTATCGTGCTTGGTCTTAAGAGCACGGAACAGAGCCTTCT
CGGCACCAAGGATCTGCACAGTAGAAGCCGGGTGCTTGGCCAAGTTCATCAGGCTGCCAGCGTGGGCAATAAGACGGGCACCCACCAGCTCGCCCACCAT
GACGGTAAGGTTAGGGGCGATGGCGTTCATGCGGTTCTTGAGGTAGTCGAAAAGCTGAGCGCGGTACTCCGTGAGGGAGATGACCTGCTCACACAGTGCC
GAGATGTTGGTcacgtcctcctcggagATGTCCGTGCCCATGGACACCTCGCACACCTCACGCATGGAggcctccacgtcctccgACAGGATATCCGAGA
AGTCGAGGTTCTTGACGTTCGAGCGCACGCCCATCTTGAGCACGCACTTGGCGTACTGCAAGTTGTCCGTCACGATCTTGCCCATCTCGGGGAAGTGCCA
TCCGAACCACTCGCGCACACGCATGGAGTACGTGTTGatctccttgtccagctcgtcgagcagaCCGATGGCCTGCACGATCATGGTGTCCACCTTGTCG
GCGCTAAACTTGAGTTTGTAGCGCGAGAGCGAGTGCGACAGACCGAGCGTCATGGCCTTcaggtcgtcgtcctccaggCCAGTGATCAACGTGTCCATGT
TGGCGCGGATGCCACGCATGACCTCGTTCACGGCGTTGTCGTTGACGCAAGCGATGctgagcttctccttgatgaAGGAGCCGAGCGCCTTATCCGACAC
GGCCAGCTTG