Description :
From Genome Similarity Track
Location :
Scaffold_23:51900- 56711
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10737hypothetical protein

Sequence
4811 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGCAAGAGCGTTCTTGCAAAGCCTGCCTT
GATGTGTGAGAATCCCGGCTCATCCTCGGCCAGCGTGAAGGCGAGACTGCTGGCGCACAGGCAGTGCCGGACTTGAGGCAGCCCTCCTTCATGCAAAATA
CTTCAAGACTCTTGGACTTGAATCAAAACCCCACACATCTTGATCCATTTTCATCGGAAAAACCGGCTAGGGTAGCCGATCTACACAGAAATTGTAGAAA
TTGTAGAGCTACCCGTTGAAAACGAGACCTGCAACACTACGATCTCCTCAACAAGTTGCTGAACAACTCCTTTGCTCGCTTTTCGTAAACTTACTTTACT
CTGCTGCACAGCGGTGCAAGTGCCGGCACCATTCATCCATGCCGGTACAGTGTCGTCTACAGGACAAAGCCGGAGGAGCATGAACAGCATTTTTTTTATT
GCCTTGTACTCAGTAGTTGTTACAGGATATTTTCTTTTAAGCATGTACAGCACCTCCGAGCCAGCCCCGACAAGAAGCCACCTCGGTGTGCTCACGCTGT
GCGGTGCTGGGCTCAGCTCGTGTTTCTGCTGCTGGTATCGCCGAACTGTCCAATCTCGGCGTTCACCATAGGCAGCTGGGACCAATTCCTGCGCTCAAGA
GCCTGTAGCCAGTCCCGTCCTATGTGAAGCAGATGGAGCGCAGTGGTGAGTCCGCGGCCAATCTGTCCCCAAAGCTGTCCCCCGAACGGATCGCTACTCA
CTCACTCTTGGATTTGCCTCCTGTCACCCAAGCACTCCTTATCAACTCCCACCCCCATTACGACCATCAGAATGGACGCCTGCCTGCAAAAGTTCGAGAC
GAGCATGGGGTCCGCGCCGACCACGCCCACCTCGTCCGAGCAAGTCACAACTCGCCGCGTTGCGCACTGGGACAGCAAGCGCGAGAAGTGCAATAACTGC
GAGCTCATCTACCTCAAGACACTGAGCCAGCACGCGGGCTTCTGCTCCGTGGACTGCAAGTCCAACATGGTATATCTCCAGAAGGTTAACCGTACCATCC
GCGCCATGAAGGACGCGGTCGATGAACGCCAACGCGTACAAGAGCAAGAGGTTCGCGAGGAACCAGTGACGCAACAAGAGCCACAGCCGGTCGAGGTCGA
GCAACAGTCTGCTGCCAAGATGCAGCCCGTGGCCTCCCCCAAGACCGACGTTGCTGCCCCCGAACCTGTGCACAGCTTGAAGCATGCGCAGTCGTTTGCT
GAGTTTGGTCTTGAAACTCGCGTGCTGGACGCCAGCAATGTCGAATGGTCTTTCAGCGCCGTGTACTAAAAAACTGAGAGCCAATTGTAAATTTAGAGCC
TCACGATAGAGTTGTAACGTGAGATGTAGAAAAGTCTGAAGCTTATAAGCTGCATTTATAAACATAGATTGCTTTTTTTTTCATCCAGCTACATTCTCCT
TTCGCGTCGAATAGAGACGGTCGATGTGCTGCGTCAATACATACCTATCTCCTCCAGGTTGGTATCTGGTAGGGAGAGAGAAAACAAGGTCTCGCTGCAT
CCTGACTGGTGTCGAACACCTTACATCATGCTAAGGTGAGTGCTCTACATGCACAAGATCTTACTTTGTGAATACGCGTATTAATCCGCAATCGCAACTA
CTACATAGCTGCGACTCGCAGTGCAAGGCCATTAATAGAATACATTCGGTGTCAATGAGCAGGGCGCTGGAGTAGCTCGCCGCCACGTGGATGCATCACA
TTACCAACGTAGGAATTGGAGACAAGTGGGATAACCGTAAGTGTGCAGTTGACTCTGTACCATGATATAAGTAAAACCTTTTGCTTCTTGTTTTGTACAA
AACGCTGAAGTTTATTTTTTTTTAATGAATTTTTTTGCAGTGCAGGTGCAATCAATTTCACTCGATATTTTGTTCAGGACAAGTGTCGATCACGATAGTT
CCCTGTCCGGCCGTCCCACATAATCGCGACCCGTAAATTTTTGACACCACGCCATTGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNN