Description :
From Genome Similarity Track
Location :
Scaffold_785:5190- 9515
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_785-snap-gene-0.8DNA ligase
Pytap_DAOMBR444maker-pag1_scaffold_785-fgenesh-gene-0.0Ribonuclease H2 subunit B

Sequence
4325 bases(100 bases per row)
CCTAGATCAGCATGTCATCGTCATCCTCGTCCCCACCCACTGTTGCGAGACCCTGGGCTCGATACAGATCGGCGATCTACAACAGCAAAAGTTAGAATTC
TAGTTGATGGTAAAGGTGAACTGTGGGCATCCATACCTGTGACGAGGTAGTTGCCTGTGTAGTGTCCTTGTCATCACGAATGCGGATGAATCGAGGGAAT
CGAAGAGAAATACCCTTGTCTTTCGCGACTTGACCGATCGCAGCTGTGTACTTTGGGGAGATCGACAAaTCAGCACCAAGAATTTCCCACACCACACTCG
GTTCAAACCAGACGTCTGGTTTGATGCCATCAGTAATAGCGTAGTCGCGATGTGGCTTATCAATGACCTTCTCCTTCAGCTGGGCGCTGAAATCCTTTAG
CTGTTCATCGTTCAGACCCGTGCCGAGCTTCGTGATAGGCTGGTACATCTCTGTCTCTGGGTCATAGCACGCCAACAAGTACGCACCATACACGCCTGTG
CGTTTGCCACGGCCGTGAAATGCGCCAATTGGAACGAGATCAGTAGAGTCACCGATGCCATCCAGATAGTCCTTCTTCAGTTTCAGCCATTTATGCGATC
TGTTCGCAGGTTCGTACGTGGCTTCTTTCTCCAATGTCTTTACCATCAATCCTTCGCAGTTTTCCTTCACAGCTTCTtCAAGGAATGTGCGCACCTTATC
GACAGCCACTTCCATCCCTTCCGCATCGTCCGCACCTGGCATCACGCCATCCACATCCACGGAAGTGGCGAACTCGAAAGATCCATCTTCGACCTCAAAC
TTCTCCTTCAGAAGTTCACGGCGTTTACCAAGTGATGTTTGGAGGAGCGACTCTCCATCCAAGTACAGCAAGTCGAAAGCATAGATGCAGACCGGCACCT
TGATATCCTCGACCTTGACATTCTTTCGAGACCGGGTACTCAAGACTTGGAACGGAAGGCGCTTGTTCGTGGCCTTGTCGACGGCGACAACTTCAGCATC
GACGATACAGCTCTTGATCTCACTCTTCTTTGCTGCCTTCGTAATCATCAACTTCACATCAGGGAAACGCTCGGTAGAGTTTTCGAAGTTACGCGAGAAA
ATCGCAATTTCACCATCGGGAAGAATGTGAATTTGGGCTCGTTCACCGTCATACTTGTACTCACAAGTGAATGGCATCCCTTGGAAACGATCGAAGACCA
TTGCGTACGCTTttGTTGGTCGAGCCAGCATCGGTGAGACAGGTGTGCCCGGAGTCAATATGCAACGTTCGGCAACCTTCGCAAAATCGGCGACTTTGAG
CAAAGGAGCAGTATCAACCTCCGACTGAACCTCCTGGAATGCCTTTACCAGTGCATTGTAGCTAGGGCACTCTGCGAAAGCCTTCTTGACAAAAGCAAGC
GCTTTCTCTTGTTTCTCCTTGTCCTTCGCGTCTTTTTCTAGCATGAAGGCATAGGTGAGGCCCATGAGAATTGATTTTTCTGCGAGACCAATCCGAAGCT
TGCCCTGCAAACCGCGAATAATGTACTTGGCCGCCTCAGCTGCCTGTTCGCTCTTTTGACCACTGGCTTTCTTGTCCTTCTCGCATTTCACCAGCAAATT
TTTTATGATTGAGCACTTCTGTTGCTGTGAGTTGTTTCCTGTCATCTTGGCAATCTTGACGAACTGATTGTACACGTCTGGCACACTCAGGACAGCTGGA
GGcTtGGCACCAGCCGCAGGCTTGATTGCAGCGAACGACAACGTATTCTGCTTCGAGCGAGCGTTCTGCGCCACTTTACCAAGATCACCCTCTTTCTGAT
ACATGTCCTTAACGAACTTCGGGTTTGTTCCAGTCGCCTCACCAATCGCCTTCATAAGAATGGCATCACCAATGCCAATCTTCAGGTTCTCGAATGGTGG
AGCCAAATCAGTACACACGCACaGGTAAATACACGCCAGGAGATCTTGTGGCGCCTTGCGGATGACCTCACGATAAAAGTtGGTGAGGAGATCCTGGATC
ACTAGACGACTGGATGAGATCTCGATCTTGCTGAAAAGCGCTGCCAACGCCGTGTACGGGATGCTCTCAACACCATCCTCGAGCGGGTTCACGACGgTAT
CAATGTTCGCCTTCTTGGCAGCCGTGTCTGCAGCAGCGGTCTTCTTCGATTTGGACGCTGCACCAGCAAAAAAGCCAGTCGCTTGGGTCTTGCCGGCGTC
CTTTTTAGCCGGCTTCGAGGCCTTTACATCTTTTTCTTCTTCTTCTTCGTCCTCATCGTCTTCTTCTTCCTCTTCCTCATTGTCTTGTGGGACATAAGCT
TCTTCTTCTTCTTCTTCTTCTTCTTCATCCTTCTCGACATCCTTCTTCTCTGTGTTTTTCTTATCAGTTTTGACTACCTCCTCTTCCTGATCATCCTCCT
TGTCAGTGTCCTTCTTGGATTCGGCCTCTGGCTCACTCGACGGTTGACTCGGTTTCTCTTTCTCTGCCTCTTCCTCCTCTTCGTCCATGTCGATCTCCAC
AACCTCATTTGCCGTTGGCTTTTTCACTGGCGCACTCATGACCAAATCATCGTCCTCCTCCGACTCATCATCATCCACAATGCGCTGACGCAGCCGACGT
CTCCCCGGCTTGGCCCGCGTCCTCTCCTCCTCCACCTGCTCCTCCATCACCACATCCTTCTCCTCCTCCTCCTCCTCCTCaTCTTCCTCCaCCTtGTgCT
TCTTCACCTCCGgTTCTTCTTCCTCTTCTTCCAGCTCTTCCTCGTCCTTTTCCACCACCTTTTCCCTTATCTCCTCCTCCTTCTTCTCCTCCTTCTCCGG
CGCCTTGCGCTTCACCACCGGCGCCGCCTTGGCGCCAGCACCAAAGAACGCTCTGTGCGCATCCATTCCCTTCATCAGCGTCCGCCATCTCCTCCTCCAG
CCCTCCATACAGCCACGTACGTGATCGCCTTCTGCTGCGTCTTCGCCTTGCCGGCCATGATGCGGACTGTTGGTTTCCTTTGCCATGGCGGGAAGTTGCC
CCACCCAAAAACCCACTTCAGCATGGGTTGATGACTACCTGGAAGTCGTGTTTTGGCGCCAACCCGTTATATTTTCTATCAAATCTAATATCCCCCAGAG
CTCTTCGTGCTGTAATTGGTCATTACCCAGAGGAGACCAAGATGGTGGAGGCGCGCAAGACCGTGGCCATCGTGCCCACGCTGCCGCCCAGCGCCAAGCT
CTCGCGCTTCCACGCAGACGCGACGGACGCGCCGCTCTACTCCGTCGTGACGTGGTCCACGCGGCACGCGCGTGGGGACAAGGGCCAGAGCGTCGCGCGG
AAGCGACAACTCGCCCTCGAACATGCGTCCCACCGCCTGCTGGAGCTCCAGCGCGTGGGCGCGTCCAAGGACAAGAACCGGAGCTGGTTCGTTGGTAACC
ACGTGCAACAAGGTGCGAGTGTGAGAGGAGGAACGAGGGAGATTGTGGGGCTGATGCGCGTGCAGATGGCAGTATGGTGGTGATGACGCCCATGGACCCG
CTCTTCGTGCTCCTGCACGCCGTCATTGAGCAGAAGGAGCGCTTTCTCTCCACCTACGACCTTCTCTCGCGTGATGAGAATGCGTGGTGGCTTCAGCTCG
GTCCCTCGCTCACGCAGGCCAAGATCGAGAAGATCTGTGACGTGCAGGACACAGGAGACGACGCCATCGACAACCTCTATGTCCGAGTCAACGAGACCAA
GACGATCGCGTGGCTCGCCACCAAGGTGCGAATCGACACGAAACCCACGCATTCCATCTTCGTAGAATAACAGGCGCATCACAGGTCGAGCGCGTGGCCA
AAACACTCGCAGTACGAGCGGCCACGGCCACCAACGGCGGAGCGTTCGACGCCAAGTTCGTCCTCCCAGGGCAAGAGACCGAGAAGAAGGCTGCAGTGAC
TACACCTGCCGATGTCACGCCCGAACAGGTCAAGCGCTTCCACCGGGACGCTGTCGACATCATCGCCGACTATCTGCCATCAAGCCTCGTGCCAGCACTG
CTCAAGCACTTCAAGTCCGTACCTGGTCTGGCTCACGCTTTCCTTCTCTGCCTGACTCCTGTTtGTTCATCAGTGTTGACGCCAGTGTGGCCACGTCTTC
GTCTTCGTCCACCAGTGCCAGCACTGCGACTGGTGCTGAGCCTATGGACGCCATCCGTCGCTTCGACCGTCGCCAGGACCCAGAGACATCGACGCCCGGC
AAACGCTCAACCCcGGCCCCcACcAGTGCCAAGAAGAAGAGCAAACTCGCGAACGTGGATCGATCCGGCATGAAATCCATCTCGTCTTTCTTCGGCAAGA
aGTAGAATCTATGAACaCGGAATGA