Description :
From Genome Similarity Track
Location :
Scaffold_1298:519- 2465
Transcript NameFunction/comments
Phymu_g13074hypothetical protein
Phymu_g13075hypothetical protein PHYSODRAFT_512708

Sequence
1946 bases(100 bases per row)
AAACTAGAATTGCCACCATCGAGTAATGCACCGCTTGTACTACAACTAAACGTCTACGGTAATCCTCACTCTCGATGGTGCCTTACCAGTAGAATTGTTT
TAGCTGCAGTACAAGTGCCGCGATTAGGTGTGTTGAGTTTCGAGTTATGCTTTTTCAGTTTCACGCTTTGAATTTGGACTTTTGCTTTTCGAGTATTGCA
TTTTCGGTTTGGGTTTTGCACTTTGCGTTTTGCTTGCAGTTTAGGGATTGCATTTTTGGGGGTTGCACTTTGGCAATTTGGATTTTACTTTTTCACTCTC
TTTGCATAAATCAAATCAAGTATAAAAACATATTCCTTTTCTTGTTGGCGATACTGTTGCGAATTTGCTGAAGGCCTTTTCCGGTTTGAATGGGTAGACG
GGAGGACGATAGGCACAATGTCGATGTCCATTACAACTTAGGCAACGAATGATGAAACGCATCAAAGAGCCTGAAAGGTGGCATGACCTGTGCTGATTGA
TTGAGTAGAGCCTGTAGGAAGGCAAGTAGAATTCACTTTCACAGAAACGTACTACTGGGCTGAGACCATCAACCGGAATGAGGAGATTGGAGCCACCCTC
TTGCTTCCAGCCTCGCCAGCTCTCCACAACAcgatgcagcttcaacagaGCAAGTCGAGTACAACAACCACTCAGCAAGNAGAAGATCGACCCGCctgcc
gatgctgctgccaccgaccCCAAAGAAGTTGCCGCCAACAAGGACGGcaacgacgatgacaagAAGGAACAGCTCGGCCTCGGTCTCGGTCTCGGTGGTT
GGGGTGCCGGTGGTTGGGGCCTCGGAGGCTGGGGTGGTTGGGGCGGATGGGGAGGCTTCGGGCCCTACCGCTTCGGGTTCATGTGCGGTGGCGTCCCTGG
CTGGGCCTACCCGATGGGTTACTGGAACCGCTACGGGTCTGGTCTGTACGGCGGTGGCTGTGGTCTTGGCATGCCTTACGGCGGTCTCTACTACTGCTGA
GTGGGCAAACTTCACTGGTGGAGCGTTGCCTTTTGCAACGTGCAGgtcgcttgaagaagagctaGGTTTGGCCACTTTCTCATGGAACCGTAGCGATCAC
AGCAACTTCTGGTAATGGGAGTGCGTCAAATTTACTTTTCGCTACGAATAAAACAGGAATTTAACACAATGTCGTTTACTTCTAGTACTTGAAGTTCTTG
TTAACGTTTCAAGCTCAATTGGTTTTGCTTTGTGGTGTGGTAGGATGTCCAGTCAACACTTGAATTGACACTACCGATAGCGAGGGTAGTTTAGGTGCAC
AACAATTTCTTGAGCGAAGAGTTTCAACGACTACTAATACTGAGCTGATAATAtttgaacttcttcagcgtACAGCACACTTTTTTACATCCTATTTCAT
TCAGGTAATTTAAAAGTAAATGACGAATGCAGTGCCTCAGCACGTGGAGACCGCGAAACGATTTACGAAACCCTGACAAAGAAACCGCGTACTCAAAAGT
GATGCTACTGGTACGCTCTTTTCGCCAATTCAACTACCCCACGCCAGTACTACTTGAAAATGTCCAACCAATTGCCGTGGATAGCGTAAAGTGAATTGGT
TCAGATTTAATTTGTCAAAAACACCGTGATTTATCTAGATTTTCCTCGGTGAGAGTTCACCAGCTCCTACCAAACATTCATgtcgacgttgcagcagttg
ctgtgTGAAAATCTCCAATGTCTCCCGCTCTCGCTTAAGTGCCACTCGAATACGACGCACAGGCGCACGGGATTCGTCCACTAACCGCACGAGATCCGGG
ATTTCTTCCTTACTGTCCtctgcgtcctcctcgttgTCTTCGGTTTTAATCACTTCCTCAGCCTCATCGGTATTTGTGACGCGTGAGAATCCACTGGCGA
CACTAGAAGCTCCCGATTTCAGTTTCCACACGTTGTGAATCGGACC