Description :
From Genome Similarity Track
Location :
Scaffold_1876:519- 2327
Sequence
1808 bases(100 bases per row)
CAGTAAGCCGTGATATTCTGCATCGTTCACAGTGACATCACTCAGGATGAAACCTTGTGCATCCAGTACGCTCCAACCAGGCAGGCTCCACAGGATGCAT
CCGCAGCTTCCTCGGCGAGTCGACGTCTTGGCTGCTCCATCGAAGCTTGACACAATCCCCTCAAAGTCAGCGTCCAACATCTCCATGCTCACCACCGGTG
GTGGCTTGACCCGCCGCTTGGCTGGAATCAGCGACTCTGCGATCCGGTCCAAGTGCTCTCGGGGGGTGATACCCGCACCGAGTATAGCGGCTAGACCGTC
TTCATCTCGCTGAATTCGGCGAACTTCCAGGTCCCACTCGGAAAGAGTGACGCCCCATGGTACGCAACGTCCATCCGCCGACTTGGACTGAATCACCCAC
TTGAGTACCGAATAGCGGGTGTACACGATTATCGAACATCCTTCCAGGATCGTCCTGAATACATTCAGTACTCTCATGATCGCGATGACTTCCTTCTCCG
CAACGTGATATCGGACTTCCGAGTCATTCAGTACACGCTCCGTGAAACGGACGGGCTGAATCAGCCCGTCATGCTCTTCACCGAGGACTGCACAGGCTGC
CCACTGGCTCGCGTGAGGAATGATGACGAACGGCTTGGTCCGGTCCGGATGACGTAGCAATGGGGTCGACACGATCTTCCGCTTCAGGATCTCGAACGCT
TCCTTCGCCCTCGCCAAGTCCCTACCGGATCGCACTTGGTCGTCGCTCAGCTCGTACAGGACTGCAGCTACCATCGGGAAATCCTCTATGAACTTATAGT
AGTAGTTCAGACTGCCGAGGAAGGACTGGATCCCCTTCAGAGTAGACGGGAATGGTAGATCCAGTACGCCCTCAGCGATCTTCGGCGTCGCCCTGAGTCC
TTCTGCACTGATCTCATGAGAGAGATACGGGATCGAGCGCTTACCGAATTCACTCTTCGGTAGACTGACAGAGATGTTCCAGTACCGCAACCGAAACAGT
AGCGCATCCAGATCGATGAAAAGTTGATCCCACGTAGGCGCCCCATGCGCGATGTCGTCAATGTACGAGCTCCGTCCTAGGACAGGGCCCATCTGCATCG
GCGCCGGGATGTTACGTTGGAACACAGTCATCCGGTCTGTCAGCGCGGGTAGACGTCGGCCAGACAGGATTTCGTCGTCCGATCCGGTGTCGCTCCCTGC
GACGTTGTCCTCTTGCAGCTTCAAACCCAGATAATCCAGTACGTCCTGATCCACCTGAGCTTCCTTACCAGGTGGTAGTCGAACAAAGCCCCACAGACAG
TTGTTGAGTATCTGCTGGTACACCAGCGGAGCATTCTTCAGACCAAATGGCATGCGTCGCCACTGGTAGTGACCGAATGGCGACACGAACGCCGAGATGA
GCTTGGCTCGCTCCGTCATCCTGATCGCCCAAAAGCCGCTGGCCATGTCCAGACTCATAAACCACATCGCGCTCTCGAACCCGATTAGCAGGTCGTCAAT
GAGCGAGAGAGGATAGTTGGACAACTGGATGAACCCGTTCACGATCCGGTAATCAATGCACATCCGGATGTCGACCCCGTTCTTCTTCAGTACGATCACG
ATCGGTGACGCCCAGGGTGACGTAGATGTCTCGATCAATCCAGTTTCCAACAACTTCTTCAGCAACGCGTACACCTTCATCGCAAGGTGTGGCGCGACCG
AGCGTGCCCTCTGTGCGACAGGCTTAGCGTCTCCCACATCCAGATCGCAAACGACTCCGCGAGCTGGGGCTGGTGCCGCATTTCCATCACCTAAGAAGAT
ACTTCGGT